Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
The second code in this case is the procedure for perfusion
Explanation:
Extracorporeal perfusion is the process of diverting the patient's blood via an artificial circulatory device to enable the gas exchange (oxygen absorbed, carbon dioxide removed) to take place. Only medical experts should handle this procedure so as to avoid any and all undesired scenarios or negligence towards patient care.
Answer:
Explanation:
Narrow sense heritability - h2
selection differential - S
Selection differential is calculated from the difference between the population average and the parental population.
Breeder's equation:
Response to selection - R = h2S
Mean milk production of 10% cows for experiment = 8.9L/hr
Mean milk production of parental population = 5.1L/hr
Selection differential S= 8.9 - 5.1 = 3.8 L/hr
Response to selection = 0.587 × 3.8 = 2.23
Answer: 2. endospores
An endospore is a structure that remains in the dormant state in some bacteria. The term endospore refers to the seed like form, but actually it is not a true spore. Endospore allows bacteria to restrain it's biological activities like obtaining food and reproduction under harsh environmental conditions like freezing and drying. Under favorable conditions these endospores reactivates. The endospore consist of bacterial DNA and ribosome.
