answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
1 year ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]1 year ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
Helper t cells are activated by ________ on ___________ cells
inessss [21]
Helper T cells become activated by interacting with antigen presenting cells. and the second blank space is either cytotoxic t cells or B cells
5 0
2 years ago
Humberto measured the length of a stick's shadow from sunrise to sunset during the day. What did he notice from his observations
statuscvo [17]

Answer: C. Shadow length decreased from sunrise to noon.

Explanation: Think about how the sun is positioned in the sky. If it was noon, the sun is above the stick which means little to no shadow at all. If the sun was rising, its hitting one side of the stick, making the shadow longer.

3 0
1 year ago
A _____ is a place that is strictly controlled in order to protect a species from extinction. wilderness wildlife sanctuary zoo
Dmitrij [34]

A wildlife sanctuary is a place that is strictly controlled in order to protect a species from extinction.

6 0
2 years ago
Read 2 more answers
Which is a possible intended result of hybridization in plants? A) The plants survive without water. B) The parent plants become
kykrilka [37]
The answer is c, people want to make a hybrid that is less likely to be diseased so that the plants wont die off
3 0
2 years ago
Read 2 more answers
Give one example of how the testing of Platismatia glauca could benefit future ecological research of this forest
Stels [109]

Answer:

Platismatia is a genus of lichens that often is found in forests. Lichens may be beneficial for forests because they provide food and nutrients for other species by fixing atmospheric nitrogen

Explanation:

The lichens are the result of mutualism between photosynthetic organisms (algae or cyanobacteria) and fungi species.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Food guides usually classify sunflower and other seeds in the _____ group.
    9·2 answers
  • Emotion has been defined as having three elements. please identify which choice below is not one of the three elements.
    11·1 answer
  • Contrast the different ways bromeliads and pitcher plants acquire nutrients from animal sources. NOT COMPARE.
    9·1 answer
  • Flour, water, salt, and yeast are mixed, given time to react, and then baked. The product is a brown loaf of bread with many tin
    10·2 answers
  • A fox is carrying a dead squirrel as a hawk swoops down to grab it. They both pull on the squirrel but the flapping wings of the
    8·1 answer
  • Discharge summary: This 3-year-old infant was placed under anesthesia for an insertion of a ureteral catheter due to congenital
    9·1 answer
  • A single gene produces two different proteins, utilizing different exons. What is the most likely explanation?
    7·1 answer
  • Give two reasons why dna evidence analysis is an imperfect science
    14·1 answer
  • Type the correct answer in the box. Spell all words correctly. What is the correct term for blocked sunlight and reduced solar r
    9·2 answers
  • What name is given to a factor which is preventing any increase in photosynthesis?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!