answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
1 year ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]1 year ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
The Punnett square predicts the ratio of genotypes in the offspring based on the genotypes of the parents. Which Punnett square
DIA [1.3K]
Hey there!

Here is your answer:

Since there are not options im going to go with what i know:

<u>(Alleles)</u>

<span><u>heterozygous: A,a</u>
</span><u>homozygous: a,a</u>

<u>Therefore the Punnett square should look like this:</u>

<u>A, a</u>
<u>a IA,a I a,a</u>
<u>a IA, a I a, a</u>

Therefore the answer is 50% A,a , and 50% a, a!

If you need anymore help feel free to ask me!

Hope this helps!

~Nonportrit

8 0
2 years ago
Read 2 more answers
Enzo is developing a model of the electron transport chain. What is the role of ATP and NADH in the model?
Solnce55 [7]
I’m pretty sure the answer is C
7 0
1 year ago
A botanist has discovered a new plant species and is trying to classify the plant. Its seed has one cotyledon, it has six flower
lana66690 [7]

The best suited group for the mentioned plant is Angiosperms and monocot.

Answer: Option C

<u>Explanation:</u>

As mentioned the seed of the plant has one cotyledon and the specific name for these type of plants whose seeds has one cotyledon is called Monocot, Suppose if the seed of the plant has two seeds, It is called dicot.

Hence we can conclude that the mentioned plant comes under monocot and not dicot.  On the other hand, Angiosperms refers to the plants that has flowers with it and gymnosperms usually includes plants without flowers and hence we can classify the plant as Angiosperm and monocot.

6 0
1 year ago
Which of the following statements best describes the role of hormones in the body? Hormones send chemical signals throughout the
uysha [10]

The right option is; Hormones are the chemical signals, which are sent all through the body to monitor other processes of the body.

Hormones are chemical messengers that are secreted from the endocrine glands, and are released directly into the bloodstream, which transports them to tissues and organs to perform their functions. Different types of hormones act on different body function and processes. Hormones influence the body’s functions, including development and growth, cognitive function and mood, sexual function and reproduction, regulation of body temperature and thirst, and food metabolism.




6 0
2 years ago
Read 2 more answers
Which sphere does the frog belong to? atmosphere biosphere geosphere hydrosphere
Mila [183]

Answer:

biosphere

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • This illustration is trying to demonstrate something that mitosis is not. in mitosis, the cells that are created are
    10·1 answer
  • Uno larguito, dos más bajitos, otro chico (small) y flaco (skinny), y otro gordazo (fat). ¿qué son?
    10·1 answer
  • When using a light microscope to view a cell she obtained from scraping under her fingernails, Ms. () notices that the cell lack
    6·1 answer
  • Arthropod exoskeletons and mollusc shells both ________.a.are secreted by the mantleb.help retain moisture in terrestrial habita
    11·1 answer
  • Describe how temperatures above 35 C most likely affect the structure and function of the starch synthase in the particular stra
    12·1 answer
  • Design an experiment to answer the question, what is the effect of caffeine on the rate of mitosis in frog eggs? Label: hypothes
    14·1 answer
  • Name the three types of population distribution, describe each, and explain the conditions that govern each.
    6·2 answers
  • All of the following are functions of the central nervous system except it interprets signals from the external environment it t
    6·1 answer
  • Why is the roof of the Hearst Tower designed to collect rainwater? Check all that apply.
    10·2 answers
  • We can think of electromagnetic waves as a kind of ongoing message being sent out by the universe. Humans are able to naturally
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!