answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
1 year ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]1 year ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
A population of raccoons is thought to be in Hardy-Weinberg equilibrium for a tail-length gene. The frequency of the dominant al
larisa [96]

Answer:

No, the lack of short-tailed animals in the sample does not suggest that the population is out of Hardy-Weinberg equilibrium in this forest. It probably means that individuals with short tails were not included in the sample by chance, as their expected frequency in the population is considerably low.

Explanation:

You will find the correct and complete explanation in the attached file due to technical problems

Download pdf
3 0
2 years ago
Why does the twilight zone of the ocean have the greatest variation in temperature?
Dafna11 [192]
A major study has shed new light on the dim layer of the ocean called the "twilight zone" -- where mysterious processes affect the ocean's ability to absorb and store carbon dioxide accumulating in our atmosphere.
4 0
1 year ago
Which excrine structure Is involved in the digestion of fat
cestrela7 [59]
The answer is:  The <span>exocrine structure that is involved in the digestion of fat is </span>liver.

<span>>The liver plays an vital role in the digestion and processing of proteins, fat and sugar.
</span><span>>The liver plays a significant role in fat digestion as well as the production of fats needed for the function of different organs of the body</span>
3 0
2 years ago
Charlie is having trouble moving his arms and legs. Charlie’s doctor diagnoses him with amyotrophic lateral sclerosis (ALS). ALS
yawa3891 [41]
The answer is E: Nervous.
7 0
1 year ago
Read 2 more answers
Which of the following statements about levels of biodiversity is correct?A. Genetic biodiversity is a measure of the total numb
Novosadov [1.4K]

Answer:

D. A population with high genetic biodiversity is better able to respond to environmental stressors.

Explanation:

The genetic biodiversity of a species is the diversity of alleles that it possesses in its genetic pool. For a given gene, a population can have one or more alleles; and the more alleles the population has, it will be more diverse. Under normal conditions (without stress), the alleles that are present in high frequency in a population,  are those that best respond to the environment where the population occurs. However, if some environmental condition changes and some type of environmental stress emerge (ie drought), it is possible that these alleles no longer respond equally effectively and then, it is possible that the  alleles that on normal conditions occur with low frequency, are more adequate to face the stress. A population with fewer alleles (less genetic diversity) has terefore fewer options to deal with environmental stressors and<u> a population with high genetic biodiversity</u> will do this better.

4 0
1 year ago
Other questions:
  • Arthropods periodically shed and discard their exoskeletons as they grow in a process called
    15·2 answers
  • Ben uses a reusable storage bag to carry snacks to school. Debbie uses a similar bag to store pencils so her backpack doesn’t ge
    15·2 answers
  • Mutations can occur as a result of many factors, including ultraviolet light or environmental pollutants such as pesticides and
    8·2 answers
  • Most marine animals live near the surface of the ocean because of ________, which supports photosynthesis by marine algae that f
    7·1 answer
  • Patrick suffers from _____, a genetic abnormality in which delayed blood clotting causes internal and external bleeding.
    5·2 answers
  • Carbohydrates and proteins are two types of macromolecules. which functional characteristic of proteins distinguishes them from
    13·1 answer
  • Which of these are healthy dating norms? Select the two correct answers.
    8·1 answer
  • Which of the following describes the structure of albumin?
    9·2 answers
  • From Earth, Star Y appears to be the brightest while Star X and Star Z appear to be similar in brightness. Which list orders the
    13·2 answers
  • Part B: Simulate Deforestation Next, you’ll build a simulation showing the changes in a portion of the forest over time. This sa
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!