answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
1 year ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]1 year ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
"the myelin sheath consists of a(n) ________."
stellarik [79]

The myelin sheath is consist of a cell called the glial cell. The glial cell is the one responsible for providing assistance in neurons as well as insulation of which will be in between of them. This type of cell is usually seen in the CNS and it has different types.

8 0
2 years ago
Which attributes would allow a cell to be larger?
Leno4ka [110]

Answer:

Perfectly cube - shaped

Explanation:

If the shape of a cell is perfectly cube- shape then its volume must be calculated with an equation:

Height×Width×number of sides and number of boxes

Surface= area of volume ratio is calculated with an equation

Area /volume

if a cell has large surface area to volume into ratio means it has greater exposure to the environment.It means that flow of nutrients and gases move freely in the small cell compared to large cell.

4 0
2 years ago
Read 2 more answers
Given that the mean cuteness of the current herd is 39.7 OMGs, the BAF workers picked the 16 cutest adults and allow them to rep
hammer [34]

Answer: 41.5 OMGs is the predicted mean cuteness in the next generation.

Explanation:

Cuteness is a way to measure relative ability of individuals with a certain genotype to reproduce successfully.

Mean cuteness is given as the summation of individual cuteness. Mean cuteness also changes in the next generation.

The mean cuteness of the current herd was given as 39.7 OMGs and after 16 individuals were chosen, the mean was given as 41.5.

This implies that there was a change already as mean cuteness will either increase or decrease in the next generation after selection. Here, 39.7 increased to 41.5 .

The predicted mean cuteness is therefore 41.5 OMGs.

3 0
2 years ago
What is the most direct source of energy for cotransport?
Zarrin [17]
The movement of one of the transported substances up its concentration gradient
8 0
2 years ago
A teacher asks her students to find the average mass of a chicken egg. Each student is provided a carton of a dozen eggs and is
ad-work [718]

If you have all the eggs weighed at different times and then write them down, after that add all of the number together. Divide the number by the amount of eggs. BOOM ANSWER!

8 0
2 years ago
Read 2 more answers
Other questions:
  • PKU and albinism are two autosomal recessive disorders,unlinked in human beings. if couple each of them heterozygous for both tr
    15·2 answers
  • A bullet enters the left lung and collapses it. which cavity has been entered?
    14·1 answer
  • What three factors are needed to establish causation sociology?
    11·1 answer
  • a group of scientists decide to post their results on the internet instead of publishing in a scientific journal. what part of t
    11·2 answers
  • Which of the following best describes the process that adds a monosaccharide to an existing to an existing polysaccharide
    13·2 answers
  • The diagram shows the molecular structure of adenosine triphosphate (ATP) The diagram shows a three-part structure. From left to
    15·2 answers
  • what do you think has motivated bhargava to produce this film? What would someone who disagrees with your stance argue is more l
    14·1 answer
  • The host range of a virus is determined by A. whether the glycoproteins or capsid proteins on its surface recognize those of the
    5·1 answer
  • Mitosis and meiosis always differ in regard to the presence of a. chromatids. b. homologs. c. bivalents. d. centromeres. e. spin
    7·2 answers
  • Manny is using a computer model to investigate the effects of substitution mutations. The model presents Manny with a long base
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!