answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
Proteins and nucleic acids both play vital roles in the structure and function of cells. Part A: Describe the monomers that make
Andre45 [30]
A) proteins are made of amino acids ( if you want to describe it more you can talk about the central dogma, dna to mRNA then mRNA to amino acids and amino acids to proteins. and you can talk about the structures of dna, primary secondary tertiary quaternary). nucleic acids are made of nucleotides ( cytosine (C), thymine (T), adenine (A), guanine (G))
8 0
2 years ago
Can you be framed by your own DNA? How might an individual’s own cells lead to false verdicts of guilt. In your explanation, pro
Rudiy27

Answer:Framed By Your Own Cells: How DNA Evidence Imprisons The Innocent ... But due to the touch-transfer properties of DNA, determining how those cells ... If we were to swab the man's hand for DNA, we might find the man's DNA, his ... Touch-transfer DNA "could falsely link someone to a crime" and forensic ...

Explanation:

6 0
2 years ago
A biologist studying ponds in Alaska wants to determine if the temperature of a pond affects the length of the fish in that pond
beks73 [17]

Answer:

A biologist studying ponds in Alaska wants to determine if the temperature of a pond affects the length of the fish in that pond. He traps and measures fish in each pond, gathering the following data:

Choose a way to represent this data using either a bar graph or a scatter plot. Then write a summary of the data to answer the question as to whether temperature is related to the size of fish.

Explanation:

6 0
2 years ago
PLEASE ANSWER WILL MARK BRAINLIEST AND 5 STAR AND THANK!!
Luden [163]
<span>Higher amounts of nitrogenous compounds will increase algal blooms, leading to less available oxygen in the water, and decrease biodiversity. -------- Let's take a look at each option and consider them in light of our knowledge. 1. These compounds will combine into larger molecules as they interact in the nitrogen cycle and become food for fish and other animals, increasing biodiversity. * This has some problems. Yes, the fertilizers will cause an increase in the food supply, but that doesn't spontaneously cause an increase in biodiversity. The only way to increase the biodiversity is to introduce new organisms. And this isn't such a mechanism. I won't pick this choice. 2. The water cycle will remove excess fertilizer naturally through evaporation, with no impact on biodiversity. * There's some issues here as well. Think about how much fertilizer runoff is considered a pollution issue. If this option were true, then we wouldn't be seeing so many news articles complaining about fertilizer running causing pollution problems. So this answer isn't any good either. 3. Nitrogenous compounds will be recycled into carbon compounds to create new organisms and increase biodiversity. * Still running into the "spontaneous increase in biodiversity" issue here. How would more carbon compounds suddenly increase the biodiversity? This answer isn't any good either. 4. Higher amounts of nitrogenous compounds will increase algal blooms, leading to less available oxygen in the water, and decrease biodiversity. * This is a real problem. Some might think that "Algae is a plant. Plants produce oxygen. Why would more algae cause the oxygen supply to decrease?" Well, the answer is pretty simple. Individual algae cells don't live very long. So you have a log of algae being produced. Releasing oxygen to the air, and then dying. And the dead algae then proceeds to decay, which does consume dissolved oxygen in the water. Which does cause the death of fish and other animals that are dependent upon that dissolved oxygen. And that does reduce the biodiversity in the area. So this is a reasonable and correct answer.</span>
5 0
2 years ago
A mushroom-shaped landform consisting of a column of less resistant rock supporting a broader extent of wind-resistant rock is t
Jobisdone [24]

A mushroom-shaped landform consisting of a column of less resistant rock supporting a broader extent of wind-resistant rock is termed a yardang. Yardangs form in environments where prevailing winds are strong and move in a single direction. Yardangs occur in various deserts of the world such as the Turkistan and the Mojave deserts.





4 0
2 years ago
Other questions:
  • The process of respiration is essential in the oxygen/carbon dioxide cycle. Respiration removes ______ from the atmosphere and p
    11·2 answers
  • Genes that carry contrasting inheritance factors are called _____. heterozygotes homozygotes alleles
    6·2 answers
  • Motor neurons are to the ________ nervous system as interneurons are to the ________ nervous system.
    8·1 answer
  • Briefly explain why a proeutectoid phase (ferrite or cementite) forms along austenite grain boundaries. hint: consult section 4.
    12·1 answer
  • If you ingest carbon in the form of sugar, that carbon is released from your body as a ‘waste product' of the kreb's (citric aci
    8·1 answer
  • Imagine that we mate two black labrador dogs with normal vision and find that three of the puppies are like the parents, but one
    9·1 answer
  • The manx phenotype in cats is caused by a dominant allele that is lethal in the homozygous state. a manx cat is crossed to a nor
    12·1 answer
  • Neurotransmitters transmit ____________ between ____________ , from neurons to glands, from neurons to organs, and from neurons
    12·1 answer
  • How does the simple primary and secondary structure of dna hold the information needed to code for the many features of multicel
    12·1 answer
  • The graph shows the changing levels of hormones during menstruation and ovulation. What is the general trend for hormones after
    16·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!