answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
In a certain plant, yellow leaves are dominant (Y) and red leaves are recessive (y). A plant with genotype Yy and a plant with Y
agasfer [191]
<span>Based on a simple Punnett square, you could predict that one of the offspring (with the genotype yy) would present with red leaves. The other three offspring would present the phenotype of the yellow leaves, because the dominant gene (Y) is present (genetypes Yy, yY, and YY).</span>
6 0
2 years ago
In the initial period of learning, ________ describes when an organism learns to connect a neutral stimulus and an unconditioned
Kipish [7]

Answer:

Option A, Acquisition

Explanation:

The first stage of learning is known as acquisition. It causes establishment of responses by pairing of Neutral stimulus, conditioning and un-conditioning stimulus. Once the association between a neutral stimulus and conditioned stimulus is established, the responses are acquired.  

For example – If a bird is trained to pick a key whenever there is a  sound of a bell, then after certain period of time an association will be established between the “ringing of bell” and “picking up of key” activity. Therefore, whenever the bird will hear the ringing sound it will search for key to be picked.

Thus, option A is correct.

3 0
2 years ago
Read 2 more answers
Which of the following statements is CORRECT regarding studies of character
pishuonlain [190]

Answer:

Explanation:

Assume that a student is given two different models of bacteria, with one model consisting of big bacteria and the other consisting of small bacteria. How can the student demonstrate the theory of endosymbiosis using the models?

5 0
2 years ago
Which of the following best explains why larger grapes have a different rate of water absorption per gram of mass than smaller g
tresset_1 [31]
B because it’s more accurate then others
5 0
2 years ago
During transcription in eukaryotes, a type of RNA polymerase called RNA polymerase II moves along the template strand of the DNA
IRINA_888 [86]
Position of the gene’s promoter on the chromosome
6 0
2 years ago
Other questions:
  • Club mosses, horsetails and ferns are types of _____.
    8·2 answers
  • An entrepreneur estimates his total profit (total revenue minus total cost) for his proposed company as p(x) = x3 − 4x2 + 5x − 2
    7·2 answers
  • Where is the greatest volume of blood found in the body?
    11·1 answer
  • Recent advances in genome sequencing technology facilitate whole-genome sequencing of nonmodel organisms. select the scientific
    9·2 answers
  • Regarding horizontal gene transfer between bacteria by conjugation, transduction, or transformation:
    8·1 answer
  • In the Miller-Urey experiment, electrical sparks were passed through a mixture of gases, including hydrogen, water vapor, methan
    15·1 answer
  • The Venn diagram represents two eukaryote kingdoms. Based on the characteristics shown, A represents __________ and B represents
    11·2 answers
  • Which of the following digestive system structures releases sodium bicarbonate into the small intestine, resulting in a change i
    11·1 answer
  • Suppose you are visiting the equator. It is noon. The Sun is at its highest point in the sky for the day, which is directly over
    13·1 answer
  • 'Main cause of depletion of ozone layer is human being ' Clarify this statement.​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!