answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
2 years ago
12

Barney: Last winter, I slipped on the outside stairs of PineTree Café and broke my leg. My fall was caused by ice on the stairs

that the restaurant failed to remove. Since the restaurant clearly did not provide a safe atmosphere for its customers, I am justified in taking it to court.
Lydia: Unwarranted lawsuits are sweeping the country—lawsuits that have no legal merit and are brought simply to make lawyers and their clients rich. If this trend continues, soon our legal system will be swamped to the point where it won’t be able to administer justice to people who truly deserve it. You therefore should drop your case against PineTree Café.
The speakers above appear to disagree on which one of the following points?
a. Barney is likely to win his case against Pinetree Café.
b. Barney’s lawsuit against Pinetree Café is unwarranted.
c. Many unwarranted lawsuits are sweeping the country.
d. The legal system will soon be unable to administer justice to people who deserve it.
Law
1 answer:
ElenaW [278]2 years ago
3 0

Answer:

B

Explanation:

You might be interested in
Discuss the interesting aspects of the poem "government driver on his retirement​
Sonbull [250]
I’m in kindergarten I don’t know
8 0
2 years ago
Select one of the three core capabilities that spans all Mission Areas?
Alex

Answer:

three core capabilities span all mission areas: Planning, Public Information and Warning, and Operational Coordination. These help to unify the mission areas and, in many ways, are necessary for the success of the remaining core capabilities.

Explanation:

7 0
2 years ago
Ryan is eight years old and lives with his single mother, who is battling addiction to heroin. His mother is arrested for posses
Allisa [31]
I would say C) neglected because of two reasons. Process of elimination and the fact that he was neglected
8 0
2 years ago
The congress members bill is an example of which type of legislation?​
WITCHER [35]
A congress members bill is an example of which type of legislation: B) a concurrent resolution. A concurrent resolute is a resolution adopted by both the houses of bicameral legislature that is non-binding and does not require the approval of the president. It is only members of congress that can introduce legislation while anyone can draft a bill. Hope this helps :)
6 0
2 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Other questions:
  • What does it mean when a solid white line separates a narrow bike lane from the right-most lane of traffic?
    14·2 answers
  • if you are preparing to tow a small trailer behind your vehicle, you are required by law to make sure the trailer has
    10·2 answers
  • Examine the SEC enforcement actions against violators of the FCPA on the "SEC Enforcement Actions: FCPA Cases" web page. Look at
    10·1 answer
  • On Monday, Travis took his four-wheeler to Reppart's Equipment & Service for repair because the steering was not working pro
    7·1 answer
  • Celia Tapia (DOB 05/18/1970) experiences issues with repeated urinary tract infections. She is in the office today to provide a
    15·1 answer
  • Using this table, calculate the marginal cost of each of these quantities of bikes. The first bike: $ The fourth bike: $ The six
    8·2 answers
  • How do elected officials try to reflect the interests of the citizens they
    7·1 answer
  • Charles offered to shovel snow from Wilma’s driveway after she sprained her ankle late in January. For the remainder of January
    15·1 answer
  • • Jill, returning home early one afternoon, finds her husband Jack on the sofa, embracing the next door neighbor, Sue. In a blin
    10·2 answers
  • The day had begun on a bright note. The sun finally peeked through the rain for the first time in a week, and the birds were sin
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!