answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
2 years ago
15

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT

CATCATCATCATTTAAGCTTCAAAGCTT
Law
1 answer:
andreyandreev [35.5K]2 years ago
7 0

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

You might be interested in
what is not considered a casualty event, regardless of whether a casualty loss or gain will be allowed?
S_A_V [24]

Answer:

Generally, you may deduct casualty and theft losses relating to your home, household items, and vehicles on your federal income tax return if the loss is caused by a federally declared disaster declared by the President. You may not deduct casualty and theft losses covered by insurance, unless you file a timely claim for reimbursement and you reduce the loss by the amount of any reimbursement or expected reimbursement.

Explanation:

8 0
1 year ago
Mr. Nguyen understands that Medicare prescription drug plans can use a formulary or list of covered drugs. He is suspicious abou
dimaraw [331]

Answer:

He should be made to understand that formularies must be developed with input from health practitioners such as pharmacists,doctors, etc.

Explanation:

Mr. Nguyen is suspicious about how plans establish these formularies. His suspicions should be allayed by explaining the basic principles of how formularies are established.

This involves the input of Health practitioners or experts who focus on various properties of the formularies to ensure it has a high efficacy and fit for consumption.

6 0
2 years ago
Bài 1: Công ty Cổ phần Tấn Tài đăng kí doanh nghiệp ngày 10/10/2015 với 3 cổ đông sáng lập là A, B, C. Công ty có vốn điều lệ là
Brums [2.3K]

Explanation:

get Garbrumeyjjethztjarhatjztjafnatmstbatnatntn

7 0
1 year ago
Charles offered to shovel snow from Wilma’s driveway after she sprained her ankle late in January. For the remainder of January
lara31 [8.8K]

Answer:

yes

Explanation:

<h3>yes, Charles can force Wilma to pay because she <u>promised</u> him to pay him cause she was thankful of him shoveling.</h3>
8 0
2 years ago
Only 1% of all collisions are caused by driver error.<br> A. True<br> B. False
Helen [10]
B. We are human we make mistakes ;)
5 0
2 years ago
Read 2 more answers
Other questions:
  • The Police Department has hired you as a consultant in a robbery investigation. A thief allegedly robbed a bank and, to escape t
    10·1 answer
  • ABC Corp. hired Wolfgang to fill the position of an accountant. ABC is in the recycling business and operates only in New York C
    10·1 answer
  • If there's an unexpected puddle under your car, it means
    15·2 answers
  • Describe the ways in which the scopes monkey trial was symbolic of the larger debate raging in society between modernity and tra
    6·2 answers
  • The Digital Millennium Copyright Act __________. Question 7 options: A) increased penalties for copyright infringement B) create
    12·1 answer
  • Which bird has two legs two wings two hands and can fly
    8·2 answers
  • Mark broke into Laura's home in the middle of the night intending to steal Laura's flat-screen television, laptop, and whatever
    13·1 answer
  • An overworked and underpaid public defender is assigned to represent a prostitute who has no prior arrests and "works" to suppor
    14·1 answer
  • (I'll give you brainliest I have a couple questions on my page! ) Gall’s theory suggested that the shape and characteristics of
    8·1 answer
  • Briefly explain the weakness of the rsa industrial development zones ?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!