answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
2 years ago
7

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAG

CTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment?
Biology
1 answer:
Pepsi [2]2 years ago
7 0

Answer:

Explanation:

Dna sequence : 5' AGGCTTAAGCTTAATCGGGCTAT3'

mRna is complementary to the DNA strand ( template strand)

mRNA synthesis occur in 5'-3' direction.

mRNA sequence :

5' UCCGAAUUCGAAUUAGCCCGAUA3'

READING FRAMES :

5' UC CGA AUU CGA AUU AGC CCG AUA 3'

5' U CCG AAU UCG AAU UAG CCC GAU A 3' ( contain one stop codon).

5' UCC GAA UUC GAA UUA GCC CGA UA 3'

Total there are 2 reading frame.

Open reading frame are those which does not contain stop codon that is why they are called open.

You might be interested in
Your bone structure, metabolism, and body fat distribution all contribute to your ____________.
yarga [219]
Your bone structure, metabolism, and body fat distribution all contribute to your body type. The difference in body types lies deeply on the genes each one has. As we grow, other factors would influence this like metabolism, fat distribution and the structure of our bones.
6 0
2 years ago
Read 2 more answers
In the Cori cycle, when glucose is degraded by glycolysis to lactate in muscle, the lactate is excreted into the blood and retur
Fantom [35]

Answer: Cori cycle  consumes more energy,it expended 4ATPs, therefore with poor efficiency.

1 Glyceraldehyde 3-phosphate dehydrogenase.

it is an enzyme which  functions in Glycolysis only, to breakdown the 6th. step of of subtrate phosphorylation of glucose.

2. glucose-6-phosphotase.

This is the enzyme that works in gluconeogenesis only to intiaate its  first step. it hydrolyse glucose-6-phosphate , to generate glucose and phosphate.

Alcohol dehydrogenase

This enzyme does not play any role with both pathways.Rather it catalysis the oxidation of primary and secondary alcohols to aldehyde and ketones. The reaction involves reduction with NADH+

phosphoenopyruvate carboxykinase

functions in the gluconeogensis pathways  for conversion of oxaloacatate to phosphoenopyruvate and CO2.

Phosphofructokinase-1

function as regulatory enzyme of glycolysis to convert  fructose-6-phosphate  and ATP hydrolysis to glucose 1, 6, bisphosphate and ADP respectively.

Phosphoglycerate mutase.

An enzyme involved in glycolytic pathway, it catalysed the 8th step of glycolysis.

Hexokinase- an enzyme of glycolytic pathway invloved in phosphorylation of glucose, to intiate the process of glycolysis.

Pyruvate dehydrogenase

This is an enzyme that converts pyruvate to acetyl Co-A.

therefore it plays no role in the two pathways, because glycolytic pathway ends with pyruvate production.

Explanation:

8 0
2 years ago
During which stage of the drawing in phase should the ability waiver be signed?
satela [25.4K]

Answer:

The correct answer is - option A. stage 1.

Explanation:

Drawing in phase is a process that make sure for better client motivation and establishes an individual as a professional. There are five stages of drawing in phase.

Stage 1 is the stage that involves the establishment process of an individual as professional by through understanding his craft, sincerity for the work,  client rapport, maintaining integrity and enthusiasm for the work and craft.

Thus, the correct answer is - option A. stage 1.

6 0
2 years ago
In one row in the table, the data for the three trials is inconsistent. Which table cell contains data that are inconsistent for
salantis [7]

Answer: A

Explanation:

The cell for trial 2 with a lot of water. Trust me

6 0
2 years ago
When an element tends to lose its valence electrons in chemical reactions , it behaves more like a When an element tends to gain
Alchen [17]

Answer:

1. metal

2. nonmetal

3. lower

4. higher

5. in the middle

Explanation:

100% Correct of answers    your welcome :)

4 0
2 years ago
Other questions:
  • In order to enter cells and be useful to the body starch must be
    12·2 answers
  • When a system is behaving erratically, a graph of data measured from the system
    7·2 answers
  • Match each chronic disease with one of its risk factors. A. Asthma Lack of physical activity B. Obesity Poor air quality C. Brea
    6·2 answers
  • An enzyme was isolated from digestive juices taken from the small intestine. an experiment was set up to test the ability of the
    5·1 answer
  • The nurse tells a client that talking with the staff members is part of the therapy program. the client responds, "i don't see h
    8·1 answer
  • In the fruit fly, Drosophila melanogaster, a spineless (no wing bristles) female fly is mated to a male that is claret (dark eye
    7·1 answer
  • In the article, which technologies have been developed to enhance space exploration? Choose all that apply.
    15·2 answers
  • Nitrogen gas from the atmosphere can be converted into a useable form of nitrogen in the soil by
    7·2 answers
  • Hypothesize how the properties of water protect the aquatic organisms living in a temperate-
    12·1 answer
  • Which of the following is not a key ingredient in cloud formation?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!