answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]2 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
Jake designed an experiment to demonstrate interactions between Earth systems. He tied a clear plastic bag firmly around some le
Natasha_Volkova [10]
It interacted with the biosphere and the atmosphere.

7 0
2 years ago
Read 2 more answers
Why are telomeres a necessary component of linear chromosomes? they maintain the length of a chromosome because dna is shortened
Setler79 [48]

Telomeres are found at the end of chromosomes to protect genes from reduction during replication of chromosomes, especially during meiosis or mitosis. They are composed of repetitive sequences that do not code for protein. Telomeres become reducted <span>especially  due</span> to the inability of the lagging strand to be completely replicated to the end of the chromosome. However, while the telomeres become shorted with every replication, the telomeres are usually slightly elongated by telomerase reverse transcriptase. 





8 0
2 years ago
When the protein gramicidin is integrated into a membrane, an H+ channel forms and the membrane becomes very permeable to proton
Aleks [24]

Answer:

Explanation:

because a proton gradient is necessary over the inner mitochondrial membrane during oxidative phosphorylation for ATP production, ATP production will decease if gramicidin is added because the inner mitochondrial membrane will become permeable and the protons will be able to move in and out, there will be no electrochemical gradient left to drive ATP production. Electron transport will not be altered because it is dependent on the availability of NADH and FADH2. proton pumping also will remain the same but it will be useless because the protons can go back and forth

8 0
2 years ago
Which of the following is an important exception to the central dogma of molecular biology? a) Proteins are responsible for most
iogann1982 [59]

Answer:

b: many genes code for RNAs that function directly in the cell

Explanation:

<em>The central dogma</em> theory describes the basic framework for gene expression in living organisms. Genetic information from DNA is encoded or transcribed as RNA which then becomes translated as proteins.

The processes that take place for gene to be successfully expressed are;

  • Replication
  • Transcription
  • Translation

<em>Replication</em> is a process whereby DNA makes a copy of itself to be distributed in daughter cells during cell division.

<em>Transcription</em> is the process whereby genetic information in DNA is encoded as RNAs. The RNAs are short-lived as they are quickly utilized in protein synthesis or <em>translation </em>process.

Hence, the RNAs do not function directly in the cells but mere intermediaries in the synthesis of proteins.

<em>The correct option is b.</em>

3 0
2 years ago
Directed pressure causes _____.
prisoha [69]
C. Sedimentary Layers, sedimentary rocks are created as a result of high pressure :)

I hope this helped!
5 0
2 years ago
Read 2 more answers
Other questions:
  • LeeAnn wants to organize her data from researching the effect of hours of sunlight on plant growth to see if there is a trend in
    8·2 answers
  • The biosphere is the highest level of organization in the hierarchy of life on earth. Rank the levels of organization from most
    5·2 answers
  • There is an ecosystem that gets abundant sun, moderate temperatures and regular rain. What might you expect in this ecosystem? A
    15·1 answer
  • On the Bahamian island of Andros, mosquitofish populations live in various, now-isolated, freshwater ponds that were once united
    7·1 answer
  • Imagine that you work at the medical examiner's office for a major metropolitan city. As Chief Medical officer, you investigate
    10·1 answer
  • A botanist has discovered a new plant species and is trying to classify the plant. Its seed has one cotyledon, it has six flower
    11·2 answers
  • If two orange heliodors have a child, what is the probability their child would be red?
    7·1 answer
  • Your roommate tells you that because she has no time to eat healthy foods, she is taking megadoses of vitamins. You warn her tha
    15·2 answers
  • explain how the rate at which fossil fuels are transferred into the atmosphere, as shown in the diagram, has altered the carbon
    10·1 answer
  • Compare and contrast the energy levels on the half-pipe, the curved ramp, and the wavy ramp. What were the similarities or diffe
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!