Yeah it haves to be C if not then it could be b I think but I probably more positive with c
Answer:
At 4 months old, the baby should receive the vaccines in order to get protected against the diseases like Diphtheria, tetanus and whooping cough, polio, Haemophilus influenzae type b, rotavirus, and pneumococcal infections. Thus, the child in the mentioned case will receive the second dose of DTaP, Hib, IPV, PCV13 and rotavirus vaccine.
Answer:
p53 gene is an important gene that regulates the proper functioning of the cell. This gene plays an important role in the cell cycle progression and acts as genome guardian.
Any mutation in p53 leads to the formation of the different types of cancer cells. The p53 gene is activated by teh phosphorylation at the particular sites. High levels of phosphorylated p53 in the cell indicates that the cells DNA is highly damaged and mutated.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
<span>Gyri
and sulci are the folds and grooves,
respectively, which characterize the surface of the human brain.</span> Gyri
are part of the brain that shows a larger surface of the brain. When the gyri
change in structure or form it shows that a body is encountering sickness and
disorders. Sulci is one of the part of the cerebral cortex that surrounds the
gyri.
