Answer:
Basically the translation of CK-B protein is inhibited in the U937D cells, despite the fact that the CK-B protein is bounded to the ribosomes. This is because(<u>mechanisms)</u> the translation is inhibited by the binding of translational repressors to the 3’UTR of the CK-B mRNA rather than the actual CK-B mRNA 3'UTR.
Furthermore, the soluble protein inhibitions is due to the reaction of the U937 cells to the short RNA sequences with the 3’UTR.
<u>The introduction of these sequences(shot segement of RNA) </u>into the U937D cells leads to CK-B synthesis. This makes 3’UTR sequences to bind to the translational repressor proteins, thus preventing them from binding to the CK-B mRNA
.
COMPLETED QUE.
A common feature of many eukaryotic mRNAS is the presence of a rather long 3' UTR, which often contains consensus sequences. Creatine kinase B (CK-B) is an enzyme important in cellular metabolism. Certain cells—termed U937D cells—have lots of CK-B mRNA, but no CK- B enzyme is present. In these cells the 5’ end of the CK-B mRNA is bound to ribosomes, the mRNA is apparently not translated. Something inhibits the translation of the CK-B mRNA in these cells. Researchers introduced numerous short segments of RNA containing only 3’UTR sequences into U937D cells. As result, the U937D cells began to synthesize the CK-B enzyme, but the total amount of CK-B mRNA did not increase. The introduction of short segments of other RNA sequences did not stimulate the synthesis of CK-B; only the 3’UTR sequences turned on the translation of the enzyme. Based on these results, <u>purpose a mechanism for how CK-B translation is inhibited in U937D cells. Explain how the introduction of short segments of RNA containing the 3'UTR sequences might remove the inhibition.</u>
<u />
Explanation:
<span>The F2 generation would have included a higher percentage of pea plants producing round, yellow peas. As the f2 generation included 315 plants producing round yellow peas, 108 with round green peas, 101 with wrinkled yellow peas, and 32 with wrinkled green peas which all are in the ratio 9:3:3:1.</span>
Answer with Explanation:
Coriolis Force - refers to the fictitious force that acts perpendicularly to the direction of a rotating motion.
Air parcel - refers to a body of air that is <em>"imaginary."</em>
Pressure gradient - the change in pressure across a given distance.
Pressure gradient force - the net force that is being directed from high pressure to low pressure.
When an<em> air parcel is at rest, </em><u>the pressure gradient force acts upon it.</u> It will then move from<em> high pressure to low pressure.</em>
However, when the air parcel starts to be in motion, its direction will be changed with the help of the Coriolis force. Thus, it moves to the right side of the Northern hemisphere.
Once the speed of the wind increases, the change in direction of the air parcel increases. This happens until the pressure gradient force and the Coriolis Force are equal in magnitude. When this happens, the wind will start blowing parallel to the points of equal pressure. The wind will now then be referred to as in "geostrophic balance."
When friction happens, the geostrophic balance breaks. The flow of the wind will be slowed down. This means that the Coriolis force will also be lessened. The air parcel will then move towards the lower region.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
