Answer:
The 5' end has free phosphate group while the 3' end has free OH group.
Explanation:
Each DNA strand has two ends that differ from each other with respect to the functional group. The nucleotide present at the 5' end of a DNA strand has a free phosphate group. This phosphate group of other nucleotides of the DNA strand is bonded in phosphodiester bonds. Likewise, the 3' end of a DNA has a free OH group. This makes the two ends of a DNA strand quite different from each other. A DNA new nucleotide can be added to the 3' end due to the presence of a free OH group.
Answer:
B. The hurricane has caused a population bottleneck
Explanation:
When there is a sudden reduction in the size of a population due to some unfavorable environmental conditions, the population is said to have experienced bottleneck. Bottleneck mostly results in genetic drift and changes the allele frequencies in the population. It is caused by some natural disasters or adverse conditions such as a hurricane.
In the given example, the hurricane removed all the birds with green feathers from the population and also has reduced the population size from 1000 to 10. Therefore, it represents the population bottleneck.
Yes, C4 is a process used by plants to survive in hot dry climates along with the CAM cycle. Hope this helps!
<h3>
Transitional fossils</h3>
Transitional fossils are any fossilized remains of a life form which show common traits to both an ancestral group and its derived descendant group.
<em> Australopithecus afarensis </em>is a hominid that represents an evolutionary transition between modern bipedal humans and their quadrupedal ape ancestors.
Similarities in DNA
All species in the world share some amount of DNA. Species that are more related to each other share bigger amount of DNA than species that are less related. For example fruit fly and modern humans share 61% of their genome and chimps and humans share 96%.
Evolution of the eye
The PAX6 gene controls where eyes develop in animals ranging from fruit flies, octopuses, to mice and humans.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
