Answer:
If you want to improve the amount of the recycling in your city, Tom need to implement a lot of initiatives and the following on this question isn't the right way to do it.
Explanation:
Whether Tom wants to improve the amount of recycling in his city, he need not to ban all plastics. What he must to do is to take plastics from houses, companies, supermarkets and other places that use this kind of material and recycle them, and change them in other products to back to the society or community. Besides recycle, he need to contact the local authority to make recycling campaigns. That's the reason to close grocery stores on Sundays isn't the right way to do in this situation. If he are wishing to close all landfills, isn't the right option to do, because you have to implement a good landfills and make it works in a right way, because is important to have an sustainable landfill without creating environmental pollution for the community, local population and the planet. But to do all of these things explained above, you have to obtain investiment and money throughout the authorities, governments or maybe businessmen from big companies.
The benefits are that you don't have to rely on limited resources and you won't be contribution to global warming but the drawbacks are that you have to find a way to make it run by itself and deal with it not working sometimes.
Explanation:
Digestion is important for breaking down food into nutrients, which the body uses for energy, growth, and cell repair. Food and drink must be changed into smaller molecules of nutrients before the blood absorbs them and carries them to cells throughout the body.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
