Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Our cells are not poisoned to death because it is metabolized by our organs.
Explanation:
- Toxins are any chemical products that damages the functioning of our body.
- To be more specific, human body do not produce any toxins. They only discrete the waste materials that are easily secreted by our body through the metabolic activities.
- Organs like liver and kidneys are responsible for fighting against the harmful waste products and toxins by throwing it out from our body.
Answer:
b. The enzyme and substrate would be stuck together.
Explanation:
Enzymes are proteins whose active site binds to specific chemical reactants (i.e., substrates), thereby forming a complex that is similar to the interaction between a lock and its key. This active complex lowers the energy of the reaction and promotes a conformational change in the substrate to break down it into multiple products. When the enzyme contains mutations in its active site, the ability to bind the substrate is altered. In this case, the enzymatic reaction can't occur because the interaction enzyme-substrate doesn't produce an active complex.
Answer:
C
Explanation:
It is more probable that the third one has a more developed sense of the vision with a large eye, and its movements. Also with a opened back to receive its nutrition and optic nerve.
Sources:
Zihlman, Adrienne. (2006). «The Ape in the Tree». International Journal of Primatology (en inglés) 27 (4): 1227-1228
Even though New Zealand has a smaller population than Australia, it has a greater population density because it covers a much smaller area. Australia’s population is approximately five times larger than New Zealand’s while the area Australia covers is approximately 30 times larger than the area New Zealand covers.
