answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
2 years ago
7

In an experiment examining the effect of leptin on the hunger of rats, rats in the __________ group are given leptin shots and r

ats in the __________ group are not given anything.
Biology
1 answer:
slavikrds [6]2 years ago
8 0

Answer:

Experimental,Control

Explanation:

  • In an experiment, there are usually two groups that are taken and one is compared to another.
  • One group is the experimental group and the other group is the control group.
  • An experimental group is the one that receives the test sample or undergoes the experimental procedure and thus, the independent variable that is being tested for is changed for this group.
  • A control group is the one that does not undergo any experimental testing and hence, the independent variable is kept constant for this group.
  • Based on the above information it can be concluded that in the given experiment the rats that receiving leptin are the experimental group whereas those that do not receive anything are the control group.
You might be interested in
32. As gradient increases, what happens to the<br> distance between isolines?
Annette [7]

Answer: Because the interval between isolines is constant, their spacing gives an visual indication of the change that occurs over a given distance, called a gradient. Hope this helps :)

Explanation:

3 0
2 years ago
(02.05 MC) Conditions under which natural selection occurs in a population of tortoises are described in the table below: Natura
Artist 52 [7]

Answer:

The answer is probably going to be D

Explanation:

The reason is because there are only a little food and then you have a variation of the same spices.  

4 0
2 years ago
Read 2 more answers
The pentose phosphate pathway is a two‑stage pathway that generates which is a reductant in many biosynthetic reactions and take
morpeh [17]

Answer:

NADPH

ribose 5-phosphate

G6P

Nonoxidative

glycolytic

Explanation:

  • The pentose phosphate pathway is a two‑stage pathway that generates NADPH which is a reductant in many biosynthetic reactions and takes part in detoxifying reactive oxygen species, and ribose 5-phosphate which is a nucleotide (DNA and RNA) precursor.
  • The substrate for the pentose phosphate pathway is G6P.
  • Nonoxidative the is the phase of the pentose phosphate pathway interconverts phosphorylated monosaccharides, some of which can feed into the glycolytic pathway.
7 0
2 years ago
Chlorenchyma and aerenchyma are modified ____________ (a) phloem (b) sclerenchyma (c) collenchyma (d) parenchyma
Alexxandr [17]

They are D) modified parenchyma

6 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Tina drew an animal cell in her science notebook. What’s wrong with the cell?
    8·2 answers
  • What happens when an essential amino acid is missing from the diet
    7·2 answers
  • A researcher is designing a laboratory experiment to determine whether the inorganic substance A affects the rate of a reaction
    8·2 answers
  • Drag the tiles to the correct boxes to complete the pairs.
    10·2 answers
  • A scientist wanted to formulate a pill to attack a specific type of bacteria that infects the throat. Which biological component
    6·2 answers
  • The plasma membrane are composed of specific types of phospholipids that are asymmetrically distributed between the two monolaye
    5·2 answers
  • In gremlins, hairy shoulders are dominant over non-hairy shoulders. Peter the Gremlin, who has very hairy shoulders, was adopted
    9·1 answer
  • Which regions best identifies where myosin would have maximum cross-bridge access to actin?
    9·1 answer
  • A scientist performs an experiment to see if acids have an effect on the health of a particular type of plant. Three sets of pla
    14·1 answer
  • Explain why leaves often contain starch​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!