Answer:
40 Cal
Explanation:
Data provided in the question:
Protein present in the broccoli = 2.6 g
Carbohydrates present in the broccoli = 6 g
Fat present in the broccoli = 0.3 g
Now,
We know,
Energy provided by protein and carbohydrates = 4 Cal / g
and,
Energy provided by Fats = 9 Cal / g
Therefore,
Total nutritional energy content = ∑(Amount × Energy provided)
= ( 2.6 × 4 ) + (6 × 4) + (0.3 × 9)
= 10.4 + 24 + 2.7
= 37.1 Cal
rounding off the answer to nearest 5 ≈ 40 Cal
Answer:
The normal role of this control element can be that of a negative modulator or regulator
Explanation:
For example, the lactose operon in the bacteria <em>Escherichia coli</em> is negatively regulated. In lactose absence a represor protein is produced, which inserts in the DNA operator site blocking transcription of structural genes. if for example a mutation affects the synthesis of this repressor, expression of structural genes will increase with no regulation.
A mutation in the DNA operator site that avoids insertion of the repressor, too.
A mutation in the gene that codes for the repressor, will also do the job
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
. 2C- acetyl Co-A from the link reaction enters the kreb Cycle to combine with 4 Carbon Oxaloacetate to form 6- Citrate
The Citrate forms intermediate Isocitrate, which eventually formed 6-C alpha ketoglutarate.
The alpha-ketoglutarate forms the intermediate succinyl-Co A, which later formed 5C-succinate.
5C -Succinate forms 4C-fumarate, the latter formed 4C-malate- which eventually formed 4C-oxaloacetate.
The 4C of these compounds is fixed, to ensure constant availability of 4C of oxaloacatate for 2C Acetyl -CoA to bind it for the cycle to continuously occur for production of first product Citric Acid from which other products are formed from.
Explanation:
Alright my friend basically it would be 30% our atmosphere and clouds are the one who do it if were more than 30% there would be a lot higher risk of cancer
