Answer:
abt 24 contraction per min is needed to maintain a relatively stable internal solute conc.
paramecium maintain its volume by preventing itself from shrinking by holding in as much water as it can.
When the water solute concentration is reduced, the number of vacuole contractions will increase. But when the water solute concentrations rise, the number of vacuole contraction will decrease.
When the number of vacuole contractions will increase, the water solute concentration is reduced. But when the water solute concentrations rise, the number of vacuole contraction will decrease. So it is cetris paribus, means when the one is increase the other one will decrease.
Answer:
Human activity affects the availability of food for deer populations in many ways. Hundreds of years ago, dear were very rare but now more civilization has occurred making more food for dear in the gardens outside of peoples houses. Also, people have started to kill organisms that they found harmful to themselves, causing the dear population not to decrease, but stay the same and reproduce.
Explanation:
Hope this helps!
A. -50 degrees, it may also be 60 degrees but -50 is much more harsh
In the image, the best conclusion from the answer choice presented about the trend in a creative career is that “the number of people in creative careers has increased because they left farm jobs that do not require critical thinking and problem solving”
<h2>Further Explanation</h2>
Thinking skills refers to mental activities that individual use to process information. Thinking skills are also mental activities that a person uses when making decisions, connections and coming up with new ideas.
Individuals use their thinking skills when they try to solve problems, ask questions or arrange pieces of information. Everyone has thinking skills but most individuals don’t use them effectively.
An individual can develop to use their thinking skills effectively over a period of time. Individuals that use their thinking skills effectively see opportunity where others see barriers or difficulties.
Good thinkers can solve any problem; they possess the ability to come up with new ideas and devise a unique solution to solve problems.
There are several types of thinking, these include
- Critical thinking
- Creative thinking
- Divergent thinking
- Analytical or convergent thinking
Thinking skills are cognitive processes and they are the basic elements of thinking.
However, there many essential thinking skills and these include
- Focusing
- Gathering
- Remembering
- Evaluating
- Organizing
- Generating
- Connecting
- Integrating
- Compiling
- Analyzing
Learn more about thinking skills at:
brainly.com/question/8775493
#learnwithbrainly
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
