answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gladu [14]
2 years ago
14

Your friend wears earbuds while driving to school each day. Is this safe? Is it legal?

Law
1 answer:
N76 [4]2 years ago
6 0

Answer:

No, and yes.

Explanation:

It is not safe to wear earbuds while driving because you can not hear what is in your surroundings as well, it it is legal.

You might be interested in
During pre-start, the mirror check may involve
AveGali [126]
B. Realigning the mirrors once you get seated
7 0
2 years ago
Read 2 more answers
Do you affirm or deny rizal's retraction? ​
andrezito [222]

Answer:

I didn't like his react (Deny)

Explanation:

He disavowed Masonry and religious thoughts that opposed Catholic belief. Which isn't really that good once you truly think about. People should have there own beliefs no one should be disavowed for it.

4 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
A primary election in which voters are required to identify a party preference before the election and are not allowed to split
marissa [1.9K]

Answer:

open primary

Explanation:

An open primary is a primary election where a voter does not have to officially belong to any political party to vote during the election. The person can also decide to form affiliation with any other party of his or her choice [different from the one he or she already belongs to] on the day of the primary election. This system has been used in Califonia and Washington respectively and voters in those occasions were not tied to any partisan affiliations.

4 0
2 years ago
In 1721, Richard Newsham was granted a patent for his “new water engine for quenching and extinguishing fires”. In reality, this
adoni [48]

Answer:

d

Explanation:

a fire engine

5 0
2 years ago
Other questions:
  • What does it mean when a solid white line separates a narrow bike lane from the right-most lane of traffic?
    14·2 answers
  • ABC Corp. hired Wolfgang to fill the position of an accountant. ABC is in the recycling business and operates only in New York C
    10·1 answer
  • Type the correct answer in the box. Spell all words correctly.
    7·1 answer
  • You're a high school teacher, and one of your colleagues has her senior English students reading Shakespeare's Macbeth. A parent
    15·2 answers
  • Describe the ways in which the scopes monkey trial was symbolic of the larger debate raging in society between modernity and tra
    6·2 answers
  • The Digital Millennium Copyright Act __________. Question 7 options: A) increased penalties for copyright infringement B) create
    12·1 answer
  • Detective Stanton gets a tip from John Bratton’s neighbor that Bratton is dealing drugs out of his house. Detective Stanton and
    6·1 answer
  • You are a police officer. Your best friend who is a murderer asked for your help to cover up his mess. Unfortunately, you are on
    10·2 answers
  • An elementary school student brings her mother, Kathryn, in for parent career day. Kathryn discusses what she does on a daily ba
    12·2 answers
  • 19. Paula’s boyfriend moved to her hometown, Oklahoma City, from Houston, Texas. Two weeks after he arrived, he asked her to pho
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!