answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexandra [31]
2 years ago
14

Researchers demonstrated that the hippocampus functions in memory processing by creating lesions in the hippocampi of rats, whic

h resulted in ________.
Select one:
a. another area of the brain compensating for the damage, enabling the brain compensate for the damage
b. memory impairment on various tasks, such as object recognition and maze running
c. rats that could not complete puzzles even when food was offered as a reward
d. rats that feared the researchers and avoided the cage that was closest to the researcher
Biology
1 answer:
Svet_ta [14]2 years ago
7 0

Answer:

b. memory impairment on various tasks, such as object recognition and maze running

Explanation:

The hippocampus is the part of the limbic system which acts as an evaluation center where short-term memory and long-term memory is being processed, and also associated with scanning and spatial map formation necessary for navigation.

Damage to the hippocampi of the brain of rats  from the lesions created in the experiment conducted by researchers, have shown an impairment of memory in rats that has to do with contextual or spatial aspects of experience as the observed in various tasks such as recognition and maze running.

You might be interested in
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
The energy trapped in fossil fuels come from energy plants converted during photosynthesis. This trapped energy is
alukav5142 [94]

Answer:

The energy trapped in fossil fuels came from the energy plants converted during photosynthesis. This trapped energy is. chemical ... are using energy for

Explanation:

6 0
2 years ago
In studying the origin of the universe, one of the primary unanswered questions is _____. what type of elements formed first app
Virty [35]

Answer:

In studying the origin of the universe, one of the primary unanswered questions is <u>what came before the big bang.</u>

Explanation:

The big bang theory can be described as a theory which scientists have proposed to explain how the universe came into existence. This theory predicts how the extremely hot temperatures and dense atmosphere might have given rise to the stars and the galaxies.

Scientists have no idea what happened before the big bang theory. Some scientists predict that there might be another universe which collapsed before the big bang theory. While other scientists claim that there was nothing before the big bang.

4 0
2 years ago
Read 2 more answers
According to the ipat model, technology that enhances our acquisition of minerals, fossil fuels, timber, and ocean fish ________
Natalka [10]
<span>According to the ipat model, technology that enhances our acquisition of minerals, fossil fuels, timber, and ocean fish increase environmental impact.
IPAT is a model or equation which expresses that 
I (stands for Environmental impact) is the product of three factors: P (stands for population), A (is affluence) and T ( for Technology). 
IPAT can be written as  (I=PAT) or I = pxAxT</span>
8 0
2 years ago
Genomic imprinting, dna methylation, and histone acetylation are all examples of
Dahasolnce [82]
E translocation is the answer
6 0
2 years ago
Other questions:
  • Jennifer has been depressed for several months, and she decided to take an overdose of sleeping pills. after taking the pills, h
    6·1 answer
  • Succession is _______. a. harmful to ecosystems b. a natural recovery process c. unnecessary for ecosystem recovery d. a one-tim
    13·2 answers
  • What is th advantage of this type of reproduction in paramecium?
    10·1 answer
  • Which objects are used in modern mapmaking? Check all that apply.
    13·2 answers
  • In this style of cladogram, the timeline moves from left to right. The farther to the right the branching point, the more recent
    9·1 answer
  • Explain in steps how overfishing of species like tuna, cod, and sardines can affect the kelp population of the bay ecosystem.
    14·1 answer
  • Mason drew the cladogram shown. Which statements best describes the cladogram? Select three options. (HURRY I WILL MARK BRAINLIE
    15·1 answer
  • What are two ways that a zoo could provide food to an animal<br> that eats plants?
    9·2 answers
  • Identify how scientists use radioactive isotopes by selecting the best answers from the drop-down menus.
    11·1 answer
  • In a population of fruit flies grown in laboratory conditions, a new phenotype arises. Instead of the typical red eyes, a purple
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!