Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
The energy trapped in fossil fuels came from the energy plants converted during photosynthesis. This trapped energy is. chemical ... are using energy for
Explanation:
Answer:
In studying the origin of the universe, one of the primary unanswered questions is <u>what came before the big bang.</u>
Explanation:
The big bang theory can be described as a theory which scientists have proposed to explain how the universe came into existence. This theory predicts how the extremely hot temperatures and dense atmosphere might have given rise to the stars and the galaxies.
Scientists have no idea what happened before the big bang theory. Some scientists predict that there might be another universe which collapsed before the big bang theory. While other scientists claim that there was nothing before the big bang.
<span>According to the ipat model, technology that enhances our acquisition of minerals, fossil fuels, timber, and ocean fish increase environmental impact.
IPAT is a model or equation which expresses that
I (stands for Environmental impact) is the product of three factors: P (stands for population), A (is affluence) and T ( for Technology).
IPAT can be written as (I=PAT) or I = pxAxT</span>
E translocation is the answer