Answer:
that the salted water osmolarity was bellow 300mOsm/L.
Explanation:
A solution with osmolarity bellow 300mOsm/L is known as hypotonic and will cause a cell to swell and eventually burst if equilibrium is not reached
Answer:
The correct answer is ''aids in the passive movement of water out of the tubule''
Explanation:
The nephron loop has a descending branch, which goes to the renal medulla, and an ascending branch, which goes back to the cortex. The nephrons of these kidneys can have loops of Henle of different dimensions. The thin segment of the loop has thin epithelial membranes, its cells are highly permeable to water, but not to solutes. The water that exits from the descending portion of the nephron loop into the medullary space is immediately reabsorbed by the peritubular capillaries, causing osmolality to increase in both the tubular fluid and the medullary interstitial fluid. The characteristics of the descending branch differ from one species to another, the normal thing is that in one way or another, the osmotic concentration of the urine that moves through it is balanced with that of the interstitial fluid.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
