Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Since the gene mutates at a rate of 0.76 base pairs every 17.1 million years, to find out the time it would take for 1 base pair to mutate can be calculated by dividing 17.1 million years by 0.76
17,100,000 ÷ 0.76 = 22.5 million years
The following equation can be used to describe this:
μ = [(r2/N2) − (r1/N1)] × ln (N2/N1) = (f1 − f2) × ln (N2/N1)
r1 = the observed number of mutants at time point 1
r2 = the observed number of mutants at the next time point
N1 and N2 are the numbers of cells at time points 1 and 2
Hope that answers the question, have a great day!
Answer:
Blood vessels in the heart dilate to increase blood pressure.
<em>Hope this helps!!!</em>
<em>
</em>
Muskrats eat oak trees and if the oak tree had a disease and all of them died. then the muskrat would have to relie on someething else to eat because muskrats eat oak trees.
