Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
These creatures depend on the sea water for nutrients, protection and to move about. At low tide,many of these creatures are exposed to the air, leaving them at risk of predator attacks andoxygen depletion. The whole eco-system of the tide pools would simply not exist without theconstant movement of the tides
Explanation:
The contents that a data in the food label is supported are
by having nutritional facts, example having the percent of carbohydrates
consumed in the food. Another thing, they often gave advice in milligrams when
having to label the nutritional fact such as having 1,300mg of calcium.
Answer:
The correct answer is - a, and b.
Explanation:
Plasticity is the ability of the change in the brain during course of life span. It is a remarkable ability to recovery after the surgery or removal of the part of the brain or injury to the brain.
The neurogenesis is the ability to the regeneration of the nervous system cell, it can occur in the adulthood as well however it takes approximately six week time.
Thus, the correct answer is - a, and b.
Answer:
The hydrophilic nature of the stain explains that these molecules are polar and charge molecules. therefore, attracts the water molecule but due to their polar nature, it will avoid lipid or fat molecules.
Adipocytes are the cells that are made up of fat or lipids that are hydrophobic due to their non-polar nature and due to this fact, these hydrophilic stains will not be able to stain adipocytes and will not be colored by the stain.
