Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Agglutinins is a antibody or other substance that causes particles to coagulate from another more thickened mass.
They are like security guards in that, they are very slow and lazy so to speak.
The letter should contain concerns about the causes and ill effects of erosion.
<h3><u>Explanation</u>:</h3>
Sir,
I am very sad to inform you that the town of Hariharanpur is suffering from continuous erosion for the last 3 years. Even after having proper knowledge about this fact, you being the mayor, are not taking any charge of this situation.
The town is situated just by the side of River Ganges which makes it's soil full of moisture. Along with the repeated deforestation and tree cutting for urbanisation, the smallest of the rain falls are also eroding a lot of soils. This can lead to severe landslides in river Ganges with severe loss of properties as well as loss of lives too.
So i request you to start embanking the river as well as to start planting new trees to save the town from getting lost under Ganges.
Thanking you,
XYZ.
Answer:
D. Increase in temperature from 20 degrees C to 37 degree C
Explanation:
A decrease in substrate concentration might not necessarily lead to an increase in enzymatic activities.
Enzymes are pH specific. Thus increasing the pH of operation from 6.8 to 7.4 might destroy the enzyme.
Reactants need to overcome a minimum energy (activation energy) before they can be converted to products. The higher this energy, the lower the rate of reaction. Hence, increasing in activation energy will lead to a lower rate of enzymatic reaction.
<em>Enzymes work optimally at a temperature that is close to the human's body temperature which is 37.5 degrees. Hence, increasing temperature from 20 degrees to 37 degrees will result in an increased enzymatic activities.</em>
The correct option is D.
Answer:
The correct answer is - It has to act together with the nervous system mainly with other systems that assist in rock climbing.
Explanation:
Rock climbing is a physical activity or sport that could practice indoor or outdoor with mountains. It is a sport that requires physical and mental strength as it requires muscle strength, coordination, or balance, agility, endurance, and mental control over body and mind.
Muscular systems involve pulling the weight of an individual towards and leg muscles to hold whereas the nervous system controls or maintain the actions of muscles and also helps in balance the body of the climber. This neuromuscular set helps in maintains the muscle's tonicity in order to execute the action of climbing.
Other than these two main body systems there are cardiovascular system, circulatory system and respiratory system also helps in providing the conditions like increase oxygen input, high heartbeat, and more.
