Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
This mutation will produce a conformational change capable of maintaining the receptor continuously in its activated mode
Explanation:
G proteins are inactive when guanosine diphosphate (GDP) is bound, while they are active when guanosine triphosphate (GTP) is bound
The correct answer of the given question above would be option A. The statement that is true of modern cell theory is that, a<span>s technology improves, so will our understanding of cells. More improvement in the technology would lead to more discoveries and also would correct other information that has been done in the past for improvement. Hope this answer helps.</span>
Answer:
Option D
Explanation:
The cornea is one of the most sensitive tissues of the body, as it is densely innervated with sensory nerve fibres via the ophthalmic division of the trigeminal nerve by way of 70–80 long ciliary nerves. Hence the answer would be option D.
The mitotic spindle forms during pro-phase, and the centrosomes move to the opposite ends of the cell. The mitotic spindle has micro tubules that capture the chromosomes. While this process begins in prophase it continues over into metaphase.
