answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
const2013 [10]
2 years ago
15

A 3 column by 5 row table. Column 1 is titled Activity with the following entries: use of materials in production, release of ca

rbon in production, energy use in production, water use in production, litter in oceans. Column 2 is titled Plastic with the following entries: +++, ++, ++, +, +++++. Column 3 is titled Paper with the following entries: +++++, +++++, +++++, +++, +.
Gina’s community is considering whether it should ban the use of plastic bags. Help her analyze the costs and benefits of using plastic and paper bags by completing the paragraph.

Based on the data presented, ____
bags have less impact on Earth’s resources. Even though _____
bags have less impact on organisms in the oceans, the production of ____
bags uses more of Earth’s materials and releases more carbon into the atmosphere.
Biology
1 answer:
Elena-2011 [213]2 years ago
4 0

Answer:

Based on the data presented, PLASTIC

bags have less impact on Earth’s resources. Even though PAPER

bags have less impact on organisms in the oceans, the production of PAPER

bags uses more of Earth’s materials and releases more carbon into the atmosphere.

Explanation:

hope this helps <3

You might be interested in
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Help please 10 points! Si-Ling Chi, Aristotle, and Mary Anning made scientific discoveries that have shaped the history of the w
Sunny_sXe [5.5K]

Answer:

The correct answer is - observation.

Explanation:

Scientists like Si-Ling Chi, Aristotle, and Mary Anning developed  various scientific processes and made discoveries that shaped the history of the world. such discoveries are discoveries related to silkworms and how to make cloth from their cocoons by Si-Ling Chi, developing the scientific method by Aristotle and  Contribution to the field of paleontology greatly by Mary Anning.

All these scientists had a different type of skill and ability and one of the skills they had a strong power of observing the things or phenomenon work and many more other aspects of the scientific process.

5 0
2 years ago
A(n) _____ is a layer of fat cells that encases and insulates many axons, and helps electrical signals travel faster down the ax
Dafna11 [192]
The right answer is Schwann cells.

<span>Schwann cells, or neurolemmocytes, are peripheral glial cells. With oligodendrocytes, they make myelin sheaths around the axons of neurons, protecting them and increasing the speed of electric nerve impulses.</span>
3 0
2 years ago
The type of selection that favored progressively larger brain size in human evolution is _______ selection
dem82 [27]
<span>T he type of selection that favored progressively larger brain size in human evolution is </span>directional selection. Directional selection is a type of natural selection (besides stabilizing selection, disruptive selection, kin selection,..)<span> in which an extreme phenotype is favored over other phenotypes. Because progressively larger brain size is an extreme phenotype this is a directional selection.</span>


6 0
2 years ago
Show how selection, genetic drift, gene flow, and mutation relate to genetic variation. Match the words in the left column to th
Semmy [17]

Answer:

1.  Mutation- increase genetic variation

2. Selection- may increase, decrease or maintain genetic variation

3. Genetic drift- decrease genetic variation.

4. Gene flow- may increase or decrease genetic variation

Explanation:

1. A mutation refers to the changes in the DNA in an organism. The mutation of genes in DNA produces new adaptive features to evolve which increases the genetic variation of the organisms.

2. The natural selection favors the species which are best suited to live in that natural conditions. The natural selection, therefore, may increase or decrease the variation in a population.

3. Genetic drift is the phenomenon occurs due to random event which changes the gene pool of the population. When the genetic drift phenomenon is observed than the genetic variation of that population usually decreases.

4. Gene flow is the phenomenon in which the gene pool changes die to immigration and emigration. Therefore the phenomenon may increase or decrease genetic variation.

8 0
2 years ago
Other questions:
  • Why is the cell theory a theory and not a law?. A. The cell theory describes the natural world.. B. The cell theory explains the
    8·1 answer
  • Heat and cold treatment of food products is practiced since time immemorial for food preservation. How does it prevent food spoi
    6·1 answer
  • What mineral is most likely used to make an MP3 player? A) talc B) zinc C) quartz D) calcium I'm pretty sure it's either zinc or
    5·2 answers
  • Restrictions that are used in solver to limit the results are called
    10·1 answer
  • It is of paramount importance to use primary, secondary, and tertiary sources in research.
    14·1 answer
  • Invasive species often unbalance the ecosystems into which they are introduced because _______.
    5·2 answers
  • Which of the following statements correctly describe(s) the driving forces for diffusion of Na+ and K+ ions through their respec
    7·2 answers
  • The insect pictured is in the order
    14·2 answers
  • 90 POINT HELP ASAP!!!!!!!!!!!
    10·2 answers
  • A population of 288 cichlids lives in a lake with ample food, oxygen, and shelter. Over the course of one year, 375 new cichlids
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!