Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
The correct answer is - observation.
Explanation:
Scientists like Si-Ling Chi, Aristotle, and Mary Anning developed various scientific processes and made discoveries that shaped the history of the world. such discoveries are discoveries related to silkworms and how to make cloth from their cocoons by Si-Ling Chi, developing the scientific method by Aristotle and Contribution to the field of paleontology greatly by Mary Anning.
All these scientists had a different type of skill and ability and one of the skills they had a strong power of observing the things or phenomenon work and many more other aspects of the scientific process.
The right answer is Schwann cells.
<span>Schwann cells, or neurolemmocytes, are peripheral glial cells. With oligodendrocytes, they make myelin sheaths around the axons of neurons, protecting them and increasing the speed of electric nerve impulses.</span>
<span>T he type of selection that favored progressively larger brain size in human evolution is
</span>directional selection. Directional selection is a type of natural selection (besides stabilizing selection, disruptive selection, kin selection,..)<span> in which an extreme phenotype is favored over other phenotypes. Because progressively larger brain size is an extreme phenotype this is a directional selection.</span>
Answer:
1. Mutation- increase genetic variation
2. Selection- may increase, decrease or maintain genetic variation
3. Genetic drift- decrease genetic variation.
4. Gene flow- may increase or decrease genetic variation
Explanation:
1. A mutation refers to the changes in the DNA in an organism. The mutation of genes in DNA produces new adaptive features to evolve which increases the genetic variation of the organisms.
2. The natural selection favors the species which are best suited to live in that natural conditions. The natural selection, therefore, may increase or decrease the variation in a population.
3. Genetic drift is the phenomenon occurs due to random event which changes the gene pool of the population. When the genetic drift phenomenon is observed than the genetic variation of that population usually decreases.
4. Gene flow is the phenomenon in which the gene pool changes die to immigration and emigration. Therefore the phenomenon may increase or decrease genetic variation.