Lycopodium is a family of fern-allies .
They are mostly a flowerless plants with widely branched, with little and simple,
needle-like like leaves that
cover the branches thickly and stem while Equisetum usually called horsetail, snake
grass because it more like a tail of a horse and its the only living genus in Equisetaceae,
a family of vascular
plants that reproduce by spores rather than
seeds.
The answer would be –genesis and –gram.
Suffixes that have a Greek or Latin roots and that are used
to combine with other words or parts of words are not called suffixes, these
kind of affixes are called combining forms.
One combing form is –genesis.
As an independent medical term, this means the origin of
something in medicine. When a doctor talks about the genesis of a contagion, he
or she is speaking of the point of origin of a contagion.
-genesis used as a suffix, can indicate a particular process
or pathogen. Example is parthenogenesis.
One combining form is –gram.
As an independent medical term, gram indicated the metric
weight of an object as a unit of mass. If nurses talk about how much serving of
food, they are talking about it in grams.
-gram signifies something written down. Example is
pictogram.
If a gene is found only on the X chromosome and not the Y chromosome, it is
said to be a sex-linked trait. Because the
gene controlling the trait is located on the sex chromosome, sex linkage is
linked to the gender of the individual. Usually such genes are found on the
X chromosome. The Y chromosome is thus missing such genes (See Diagram above.).
The result is that females will have two copies of the sex-linked gene while
males will only have one copy of this gene. If the gene is recessive, then males
only need one such recessive gene to have a sex-linked trait rather than the
customary two recessive genes for traits that are not sex-linked. This is why
males exhibit some traits more frequently than females.
<span>Examples of Sex-linked Traits: </span>
Red-green colorblindness
Male Pattern Baldness
Hemophilia
<span>Duchenne Muscular Dystrophy</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
<span>Two types of macromolecules: nucleic acid and protein.
Chromosomes are how the DNA is stored so they primarily contain nucleic acids. In addition to properly organize and condense the DNA, proteins are required. These include histones and other proteins.</span>
