Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
The normal body temperature for humans is 37 degrees Celsius. Most of the enzymes of a human's bodywork best at this temperature. If an enzyme was discovered which works best at 39 degrees Celsius, then it means that the enzyme works at elevated temperatures for events which require slightly higher temperatures.
The enzyme will most probably work for overcoming fever or for reducing the temperature of the body after exercise.
Answer:
Option A, shared their data with colleagues to obtain feedback on the work.
Explanation:
All researchers prefer to share their findings with their peers or other researchers working in the same field to get their reviews. This step is very essential as it makes the research authentic and removes the flaws that would have otherwise missed by the researcher.
Peer reviewers also give useful suggestion to further modify one’s research study based on their experiences.
Hence, option A is correct
Answer:
The statement that best explains the mechanisms of inheritance of gene "The allele for blue is an X-linked dominant allele because there are no blue male offspring in cross 2."
Explanation:
The mechanism for inheritance of gene is the condition, in which the mutation when happens in one allele and cause the effect in the relevant phenotype. Similar inheritance will also be seen when the mutated allele will produce new type of the protein which will have deletorious effect on the normal function of the cell. In case of the single gene, autosomal dominant, autosomal recessive, X-linked dominant, X- linked recessive and mitochondrial are modes of inheritance.
Answer:
2(8x^2-13x+10)
Explanation:
There are 5 angle s in a pentagon and we are assuming are pentagon is a regular one so the angles are all congruent.
Let's let A represent the measurement of one of the those angles in our pentagon.
The sum of our angles in our pentagon would then be A+A+A+A+A or 5A.
But we are also given that this equals 40x^2-65x+50.
So that means 5A=40x^2-65x+50.
If we divide both sides by 5 we can find what one of our angles is in terms of x. So let's do that A=8x^2-13x+10.
So we want to know the sum of two our angles, we want to know what is A+A or 2A. 2A=2(8x^2-13x+10). To obtain that I just multiplied both sides of A=8x^2-13x+10 by 2.
