answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
2 years ago
10

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.

Biology
1 answer:
dusya [7]2 years ago
8 0

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

You might be interested in
How is the message from the brain sent in response to the stimuli?
ivolga24 [154]
When a stimulus is being detected, this stimulus is being sent to the brain through the sensory neuron, going to the spinal cord then to the brain. The brain then interprets these stimuli, and responds to it using the motor neurons. These are the neurons that are responsible in our actions depending on the stimuli we are exposed to. Hope this helps.
3 0
2 years ago
Read 2 more answers
45. Which observation of dihybrid crosses led to Mendel's law of independent assortment?
Levart [38]
I believe i the correct answer is c because he notices that some of the traits weren't being passed on.
<span />
3 0
2 years ago
The pH of a solution determines the charge of certain R groups. The pH of pineapple fruit ranges from 3.5 to 5.2. Predict the ef
Komok [63]

Answer:

The activity of Bromine will reduce

Explanation:

Bromine is found in pineapple stem with pH range of 3.5- 5.2 this implies that the environment where bromine is found is acidic hence when taken to a product whose pH is 11 which is basic then its performance will be low because its can only function well in an acidic medium.

pH ranges tell whether a substance is acidic, basic or neural.

Acid range from 3.5-6

7- neutral

8 above is basic

8 0
2 years ago
Explain why straightening an athlete's leg and rubbing it vigorously helps to relieve a muscle cramp.
Monica [59]
Muscle cramp refers to the sudden contraction of an involuntary muscle. It can be caused by many factors including inadequate presence of some minerals such as calcium in the body; it can also be caused by poor circulation.
Straightening an althelete's leg and rubbing it vigorously make the muscle to relax and to snap back in place.
5 0
2 years ago
Which statements are true? Check all that apply. In eukaryotes, DNA is found in the cytoplasm of the cell. RNA is the nucleic ac
IgorC [24]
RNA is the nucleic acid that helps build proteins. DNA is the nucleic acid that carries genetic information. The structure of proteins is determined by DNA. These answer are true

5 0
2 years ago
Read 2 more answers
Other questions:
  • Which situation does not illustrate kinetic energy?
    6·2 answers
  • Describe different ways that cell shape can be modified so that diffusion rate will be increased
    6·1 answer
  • The ________ does most of the focusing of the light onto the retina, and the ________ allows for more accuracy of focusing.
    14·2 answers
  • ​____ hormones produce detrimental and undesirable side effects (even more so in women) such as hypertension, fluid retention, d
    9·2 answers
  • Suppose the size of a population of marmots is 300. According to genetic drift theory, what is the probability that a newly aris
    5·1 answer
  • Which of the following does not affect the spatial distribution of a population?
    7·1 answer
  • A — is a chemical substance that organisms require to live
    12·2 answers
  • 11. Fill in the blanks to describe the similarities between transcription and DNA
    13·1 answer
  • A student investigated whether ants dig more tunnels in the light or in the dark. She thought that ants used the filtered light
    13·1 answer
  • In eukaryotic cells, genes each have a specific combination of regulatory DNA sequences. How do these combinations help cells ca
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!