Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Si los continentes no se han movido, entonces esto sugeriría una capa de hielo que se extendía desde el polo sur hasta el ecuador en este momento, lo cual es poco probable ya que el Reino Unido en ese momento también estaba cerca del ecuador y tiene extensos depósitos de carbón y piedra caliza. Si los continentes del hemisferio sur se vuelven a ensamblar cerca del polo sur, entonces la capa de hielo Permo-Carbonífero asume un tamaño mucho más razonable. Más evidencia proviene de las estrías glaciales, arañazos en el lecho rocoso hechos por bloques de roca incrustados en el hielo como el glaciar se mueve. Estos muestran la dirección del glaciar y sugieren que el hielo fluyó desde un solo punto central.
Answer:
water
Explanation:
in poor soil most of the water would get sucked up into more powerful plants [larger plants]
Answer:
A
Explanation:
The correct answer would be that <u>the cell was submerged in a hypertonic solution.</u>
<em>A hypertonic solution is a solution with a higher concentration of solutes than that of the cytosol of a cell suspended in it. When a cell is suspended in a hypertonic solution, water moves osmotically from the cytosol to the hypertonic solution. This causes the cytoplasm to collapse and the cell becomes flaccid. </em>
The correct option is A.
Fungi is what decomposes things and puts nitrogen back into the ground. without the fungi plants would soon begin to run out of the nutrients they need. lack in vegetation would soon form. animals would then start to die of or migrate to different locations. so eventually you would begin to see less food and more wildlife in town because of the food shortage.