answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ololo11 [35]
2 years ago
14

Tidal fluctuations can affect the abundance of aquatic organisms in an ocean environment. which tide would have the *least* impa

ct on an abundance of aquatic organisms?
a. diurnal
b. mixed
c. neap
d. semi-diurnal
Biology
1 answer:
Alisiya [41]2 years ago
8 0
The best and most correct answer among the choices provided by the question is the third choice "neap"

Neap tides<span> occur twice a month when the sun and moon are at right angles to the Earth. When this is the case, their total gravitational pull on the Earth's water is weakened because it comes from two different directions.</span>

I hope my answer has come to your help. God bless and have a nice day ahead!
You might be interested in
Sometimes a suffix functions independently as a medical term. give two examples of suffixes that are also terms, and explain how
aleksandrvk [35]

The answer would be –genesis and –gram. 

Suffixes that have a Greek or Latin roots and that are used to combine with other words or parts of words are not called suffixes, these kind of affixes are called combining forms.


One combing form is –genesis.


As an independent medical term, this means the origin of something in medicine. When a doctor talks about the genesis of a contagion, he or she is speaking of the point of origin of a contagion.


-genesis used as a suffix, can indicate a particular process or pathogen. Example is parthenogenesis.


One combining form is –gram.


As an independent medical term, gram indicated the metric weight of an object as a unit of mass. If nurses talk about how much serving of food, they are talking about it in grams.

-gram signifies something written down. Example is pictogram.

8 0
3 years ago
Evaluate accenture's history of branding campaigns. what remains consistent throughout?
muminat
Evaluation of branding accenture compaigns
3 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
DNA polymerases are capable of editing and error correction, whereas the capacity for error correction in RNA polymerases appear
Taya2010 [7]

Explanation:

DNA polymerase replicates the DNA supplied to all new cells produced while RNA polymerase drives DNA copy RNA synthesis. Unless corrected, error in DNA replication could result in the transmission of the error DNA to all next-generation cells.

Protein synthesis error will cause faulty copies of RNA and degraded proteins. To order to ensure the transfer of key genetic information to future generations of cells, failure to DNA replication must be corrected.

7 0
2 years ago
"a female distance runner has come into the training room complaining of pain on the lateral side of her hip just above the grea
Radda [10]

Answer:

rheumatoid arthritis

Explanation:

8 0
2 years ago
Other questions:
  • Tina drew an animal cell in her science notebook. What’s wrong with the cell?
    8·2 answers
  • Why are frog egg laid in long gelatin fluid ?
    7·1 answer
  • Which statement describes both scavengers and detritivores
    6·2 answers
  • Comparative embryology definition
    8·1 answer
  • What are the functions of the sori found on the leaves
    5·1 answer
  • Loss of biodiversity matters not only with regard to mammals or other vertebrates, but also microbes. What statement below would
    10·1 answer
  • The cells that perform immunological surveillance are the ________ cells.
    11·1 answer
  • Convert enzyme concentrations of 2.5%, 5.0%, and 10% to ppt units.
    6·1 answer
  • What is the significance of study human biology in understanding cultural capacity? Explain your answer with atleast 1 paragraph
    7·1 answer
  • In which two Earth regions is oxygen the second most abundant element by volume?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!