The answer would be –genesis and –gram.
Suffixes that have a Greek or Latin roots and that are used
to combine with other words or parts of words are not called suffixes, these
kind of affixes are called combining forms.
One combing form is –genesis.
As an independent medical term, this means the origin of
something in medicine. When a doctor talks about the genesis of a contagion, he
or she is speaking of the point of origin of a contagion.
-genesis used as a suffix, can indicate a particular process
or pathogen. Example is parthenogenesis.
One combining form is –gram.
As an independent medical term, gram indicated the metric
weight of an object as a unit of mass. If nurses talk about how much serving of
food, they are talking about it in grams.
-gram signifies something written down. Example is
pictogram.
Evaluation of branding accenture compaigns
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Explanation:
DNA polymerase replicates the DNA supplied to all new cells produced while RNA polymerase drives DNA copy RNA synthesis. Unless corrected, error in DNA replication could result in the transmission of the error DNA to all next-generation cells.
Protein synthesis error will cause faulty copies of RNA and degraded proteins. To order to ensure the transfer of key genetic information to future generations of cells, failure to DNA replication must be corrected.
