Answer:
Change occur in form and structure of the cell.
Explanation:
The structure and shape of the cell change because the function of leg is different from the lungs. In the lungs the epithelial lung cell is responsible for the detection and protection of the cells against pathogen while on the other hand, the leg has the function to move an individual from one place to another so due to difference in function, the cells of both regions have different shape and structure of the cell and the epithelial lung cell will be changed into a leg muscle cell.
Answer: pH 5 Acidic environment.
Explanation:
The fungi grows best in the acidic environment, this is because the fungi grows in a moist, warm and darker environment.
The fungus grows at lower pH. When the fungal species was grown in the laboratory conditions then under low pH, the fungal species grow more properly.
Hence, the best environment for the growth of fungus is pH 5.
The alula is a small structure that is found on birds. It is located at the joint between the hand wing and the arm wings of birds and it is the freely moving, first digit of a bird's wing. It is normally used by birds in slow flight. In humans, the structure that is comparable to the alula is the thumb.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
