<span>During germination, peas grow and develop. The information table demonstrates the carbon dioxide created amid the germination time of peas under various conditions. Condition Rate of carbon dioxide created (mL/min) Germinating peas, 10ºC 0.01 Germinating peas, 20ºC 0.02 What is the best conclusion?
The best conclusion for the outcomes excerpting from the information table that demonstrates the carbon dioxide created amid the germination time of peas under various conditions is an immediate and positive connection in its connections. Obviously, the developing time frame develops in the interim of 1 and 10 in both temperature and carbon dioxide created.</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
The factors which remained constant are as follows -
- material used as the membrane
- amount of substances used
- number of trials
The factors which have shown variation are as follows -
- molecule size (large starch molecules vs. small glucose molecules)
- whether the molecules diffused through the membrane (tubing)
Explanation
Some factors with in the experiments remained constant from the point of starting of the experiment to its end. While some factors were varied to study its impact on the experiment rate of progression or on the final product formed. Thus , out of the following given factors, the ones that remained constant are -
- material used as the membrane
- amount of substances used
- number of trials
The factors which have shown variation are as follows -
- molecule size (large starch molecules vs. small glucose molecules)
- whether the molecules diffused through the membrane (tubing)
Hairs are mostly fibrous proteins and are composed of keratin, and also the main constituent of skin, nails, wool, woof, feathers etc.
Keratin is the essential fibrous protein which has a structural and protective functions in the epithelium.
