Answer:
C. The rates of birth and immigration were balanced by the rates of death and emigration
.
Explanation:
A stable population size means that, over the years, number of individuals doesn't change significantly. This condition is only possible when the birth rate and immigration rate is balanced with the death rate and emigration rate. In this scenario, population size would not change much.
On the other hand, if a birth rate and immigration rate will increase, the population size in any area would be increased. This typically happens in growing cities. By contrast, if death rate and emigration rate increases, the size of population will decrease. This happens mostly in rural areas.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Does the movement of molecules stop when the concentration of a solute is equal on both sides of a membrane?
This rock can be classified as:
an igneous rock.
Igneous rocks are made up of
randomly arranged interlocking crystals and the important minerals that can be
found in igneous rocks are feldspars, quartz, olivines, pyroxenes, amphiboles,
and mafic minerals. All of these minerals are important in the formation of
almost all igneous rocks, and they are basic to their classification.
Answer:
They are stored as carbohydrate or fat
Explanation:
The amine group in the amino acids that constitute the excess protein are removed and converted into urea or uric acid in a process known as deamination.
The remaining portion of the amino acids which is essentially carbon and hydrogen is converted into carbohydrate or fat and later oxidized to generate energy for the body.
