The best suited group for the mentioned plant is Angiosperms and monocot.
Answer: Option C
<u>Explanation:</u>
As mentioned the seed of the plant has one cotyledon and the specific name for these type of plants whose seeds has one cotyledon is called Monocot, Suppose if the seed of the plant has two seeds, It is called dicot.
Hence we can conclude that the mentioned plant comes under monocot and not dicot. On the other hand, Angiosperms refers to the plants that has flowers with it and gymnosperms usually includes plants without flowers and hence we can classify the plant as Angiosperm and monocot.
Answer:
The box will not move because balanced forces are acting on it.
Explanation:
According to Newton's first law of motion, an object will remain in its state of rest or motion along a straight line unless acted upon by an unbalanced force.
An unbalanced force is an individual force acting on any side of an object which is not balanced by a force of equal magnitude acting in the opposite direction.
From the image, two forces of equal magnitude of 10 N are pulling the 100 kg box in opposite directions. Since the two forces, 10 N each are pulling the object in opposite directions, they are balanced forces. Therefore, the box will not move because balanced forces are acting on it.
Answer:
If I were to guess its probably Vascular
Explanation:
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
The answers are:
A. DNA replication in the nucleus of a cell
B. From one helix of DNA in a replication process, we get two: The DNA is a double helix and it consists of two strands of specifically connected amino-acids. When the time for replication comes, a set of enzymes unwind the two strands and leave them as a base for additional two strands attaching to them - the green line is an example of that. The free nucleotides - adenine, guanine, thymine and cytosine are left open and the enzyme called DNA-polymerase helps to produce a new strand on the template of the old parental one (one of the blue ones in the picture)
C. By the location on the smaller picture - replication takes place in the nucleus. And the most important hint are the letters A - adenine, G - guanine, T- thymine, and C-cytosine. A connects with T, and G connects with C.
