Answer: The correct terms for completing the concept of energy and trophic levels are as follows-
a) Solar energy
b) Trophic levels
c) Heat
d) Tertiary consumers
e) Secondary consumers
f) Primary consumers
g) Primary producers
h) Decomposers.
Energy flow in an ecosystem is driven by solar energy that is captured and converted into chemical energy by primary producers ( like green plants and algae). The energy moves through different trophic levels according to the 10% law of energy transfer and the rest energy is released as heat.
Primary producers are eaten by primary consumers, which are eaten by secondary consumers that are eaten by tertiary consumers. The organic matter that becomes dead is ultimately decomposed with the help of decomposers.
The unconscious id, according to Sigmund Freud, was the part of the mind composed of biological drives and the source of psychic energy.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
I think the answer is B
Explanation:
Because using logic on this situations is best idk
