answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
5

What is the mRNA in TACCGGATGCCAGATCAAATC?

Biology
1 answer:
Softa [21]2 years ago
3 0

Answer:

AUGGCCUACGGUCUAGUUUAG

You might be interested in
The Lotka-Volterra model produces consistently identical cycles because it is deterministic. The lynx and hare simulation on the
Setler [38]

Answer:

B. In the real world, random and unpredictable events occur, so the Lotka-Volterra parameters vary over time

Explanation:

Lotka-Volterra equations are mathematical models that explain biological prey-predator interactions among two species, considering the following assumptions,      

  • The ecosystem is isolated and closed. There is no migration.
  • The whole individuals are reproductively equivalent.
  • In the absence of the predator, prey shows an exponential growth rate. The prey is in the ideal environment.
  • In the absence of the prey, the predator population decreases exponentially.  The predator environment is also ideal, but it is limited by the prey density.  
  • The predation rate is proportional to the encounters rate, which also depends on density.
  • The predators affect the prey populations, making it decrease proportionally to the number of prey and predators present.
  • The prey population also influence the predator population, proportionally to the number of encounters between the two species.

In these equations, the variable D is the number of predators, and P the number of preys.

The parameters are always constant:  

  • r1: prey growth rate.
  • a1: predator hunting success.
  • r2: predator growth rate.
  • a2: the success of the predator in hunting and feeding.

In nature, there are many factors affecting interactions. Dense-dependent factors and dense-independent factors. Also in reality there are stochastic factors. <em>Stochasticity refers to the variability in the system involving those factors that are affecting or influencing the population growth. Stochasticity might be related to good years and bad years for population growth.</em>

In a real situation, the compliance of the whole assumptions does not occur. The previously mentioned constants might vary, changing continuously the interaction among the predator and the prey. These parameters change in different degrees, resulting in different circumstances for both species.  

6 0
2 years ago
Which of the following statement(s) is/are TRUE about Red Blood Cells (RBCs)? a) A normal RBC has a nucleus RBCs' production is
olga_2 [115]

Answer:

RBCs' production is controlled by erythropoietin.

Mature RBCs are released into the bloodstream after approximately seven days RBCs are produced in the bone marrow

Explanation:

The hormone erythropoietin is produced and released in the bloodstream by peritubular interstitial cells of kidneys. The function of erythropoietin is to increase the number of the precursors of red blood cells and thereby to stimulate the production of red blood cells in the bone marrow. When the oxygen supply to body cells is reduced, the hormone erythropoietin stimulates the development of proerythroblasts into reticulocytes and thereby increases the RBC production.

RBCs are produced by the process of erythropoiesis and take about seven days to become mature and to be released in circulation to serve the function of oxygen delivery. The maturation of RBCs also includes the loss of most of the organelles such as the nucleus and mitochondria to accommodate hemoglobin protein. The life span of circulating RBCs is about 100-120 days.

4 0
2 years ago
Help me on problem 13 and 14
SVETLANKA909090 [29]
(13) is bass
(14) is algae
hope I'll help
8 0
2 years ago
Is a prosthetic group present in several components of the electron transport chain?
jarptica [38.1K]

The answer is true. The prosthetic group is present in several components of the electron transport chain. The complexes one, two and three can have a presence of prosthetic group in which is being referred to as the iron sulfur clusters.

5 0
2 years ago
Polycystic ovary syndrome is an endocrine disorder and a common cause of chronic anovulation. In addition to the clinical manife
Scilla [17]

Answer:

1. Insulin resistance and diabetes

2. Metformin

Explanation:

Metformin can be used to treat polycystic ovary syndrome, especially for insulin-resistant women (insulin is a hormone that transports sugar into cells).

People with insulin resistance have high levels of this hormone in their blood and excess circulating insulin can aggravate manifestations of polycystic ovary syndrome, and also increase the risk of diabetes.

The main benefits of metformin in the treatment of polycystic ovaries is the normalization of menstrual irregularity and the restoration of ovulatory cycles.

Since most women with polycystic ovary syndrome are insulin resistant, metformin is a good treatment option in some cases.

However, the treatment of polycystic ovary syndrome should be individualized for each woman, depending on the symptoms presented and the goal to be achieved with the treatment.

8 0
2 years ago
Other questions:
  • What are microscopic particles called?
    6·2 answers
  • Which of these phenomena cause uneven heating of the Earth?
    15·2 answers
  • Drag each label into the proper position to identify whether the indicated structure is located on the femur, humerus, or both.
    14·2 answers
  • ) when someone applies for their california driver's license, they give _____ to be tested by breath or blood whenever requested
    12·1 answer
  • Which is the most efficient way to avoid DNA mutations from UV radiation?
    11·2 answers
  • A bacteria in a hypotonic solution will tend to:
    13·1 answer
  • Which details from the text reflect the cultural context of the historical period in which Marco Polo wrote his travelogue? Chec
    13·2 answers
  • What is the difference between the cryosphere and the<br> hydrosphere?
    11·1 answer
  • Most species of deer are known to eat many different types of plants. Other than being herbivores, identify the category of spec
    15·1 answer
  • Chloroplasts play an important role in energy production in plant cells. However, some parts of a plant, like the roots, lack ch
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!