answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
2 years ago
3

True or False: The aggressive driver typically accepts that these collision-causing behaviors are aggressive.

Biology
2 answers:
Aneli [31]2 years ago
7 0
Hello kiddio!

the answer is false
This could depend on the person who caused the collision. However, it would most likely be false because very rarely will the person want to accept the consequences.

Have a nice day
Tomtit [17]2 years ago
4 0
This is ........................................................False 
You might be interested in
The Weaver birds from the African savanna exhibit a trade-off between risking starvation and being hunted by predators. As a res
oksano4ka [1.4K]
Vigilance is the natural selection at work.
5 0
2 years ago
Read 2 more answers
A friend tells you that he recently read an article claiming that you need to work to restore the alkalinity of your blood to re
statuscvo [17]

Answer:

d. The normal pH of human blood is already in the alkaline range.

Explanation:

The blood has an average pH between 7.35 and 7.45. Also, in blood there are some natural buffers that allows to maintain this pH does not matter the kind of food or substances that enter to our body.

If for any process the pH decreases a little bit, the body starts a process to recover the natural pH of the blood.

5 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
The white feathers of a snowy owl allow it to blend in with its environment during the winter months (snow). This is an example
umka2103 [35]

Answer:

Adaptation

Explanation:

6 0
2 years ago
Read 2 more answers
When two objects are near each other, how would increasing one object's mass affect it
Bumek [7]

Answer:

When two objects are near each other, increasing one object's mass would cause the gravitational force of the object to increase. where m and M are the masses of the two objects, d is the distance between their centres, and G is the gravitational constant.

Explanation:

one is big one is small

4 0
2 years ago
Other questions:
  • 3. Which of the following is a characteristic that could be applied to both living and nonliving things? (1 point)
    11·1 answer
  • Compared to the outside surface, the inside of a resting cell membrane is
    6·1 answer
  • Things like your eye color and height are not under your control. This is because they are determined by your genes. So, eye col
    6·1 answer
  • Your roommate�s brother and sister-in-law just had a baby girl. their daughter was born with very low birth weight. they did not
    14·1 answer
  • Spheroplasts, protoplasts, and mycoplasms are bacterial cells without cell walls. True or false?
    5·2 answers
  • A scientist is using a ­computer model to predict changes to a population of ­rabbits in a meadow. Identify the information abou
    15·1 answer
  • _______________ refers to the vibration of sound waves on the ear drums and the sending of messages to the central auditory syst
    5·2 answers
  • An experiment was performed to determine the mode of inheritance of two mouse genes, one for fur color and one for fur length. I
    7·1 answer
  • Which situation describes mutualism?
    15·2 answers
  • Which of the following statements accurately describes fat cell development? a. The number of fat cells grows substantially duri
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!