answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
1 year ago
6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequen

ce
5’ agcgggatgagcgcatgtggcgcataactg3’

3’ tcgccctactcgcgtacaccgcgtattgac5’
Biology
1 answer:
kati45 [8]1 year ago
5 0
This is the DNA. I'm going to only use the upper strand to demonstrate what this strand would code for before and after a single bp deletion (so write it as mRNA). I will also write it how it's easier to see this which is to split them up into the 3 base codon system. Note that you don't need to know the amino acid code - you use a table to find these.

ORIGINAL (mRNA on top, Amino Acid (AA) on bottom:

5'-AGC GGG AUG AGC GCA UGU GGC GCA UAA CUG-3'
    SER  GLY  MET SER ALA  CYS GLY ALA  STOP LEU 

Note that the protein would stop being made at the stop codon and the LEU wouldn't matter at the end...

Now, I will remove one bp...(I bolded it up top). Rewrite the mRNA and find the corresponding AA...

NEW
5'-AGC GGG AUG GCG CAU GTG GCG CAU AAC UG-3'
   SER  GLY  MET  ALA  HIS   VAL  ALA   HIS  ASN .....

Completely different amino acid sequence after the methionine (MET). The stop codon is gone...the protein would continue being translated until it reaches another stop codon...so not what was supposed to be made! 
You might be interested in
Which phrases correspond to "spontaneous generation?"?
vova2212 [387]

Answer:

2 & 4

Explanation:

The theory of spontaneous generation stipulated that life emanated spontaneously from ‘nothing’. This was believed to be true until Francesco Redi & Luis Pasteur later falsified this theory using an experiment. He had two plates of cooked meat. He covered one with a glass bowl and left the other open. The plate with a bowl did not develop maggots while the open one did. This showed that maggot was as a result of hatched eggs that were deposited by flies. Life, therefore, emanates from life.

4 0
1 year ago
Read 2 more answers
The interaction between two polar molecules would involve ________.
denpristay [2]
The interaction between two polar molecules would involve HYDROGEN BONDS.
Polar molecules are molecules that have both positive and negative charges as a result of the differences in the electronegativity of the atoms that made up the molecule. Polar molecules interact through dipole dipole inter molecular forces and hydrogen bonds.
7 0
1 year ago
You are measuring length with a meter stick. however you do not realize that the first 4.0 centimeters of the meter stick are mi
ehidna [41]

Answer: Option B.

Precise but inaccurate.

Explanation:

It is precise because the measurement taken with well incremated tool reflect how close it is to the actual value i.e it has the quality of been exact but diet to the missing of 4.0 centimeter because a hungry beaver made a snack of it earlier that day the measurements will be INACCURATE because it does not conform with the result of the standard or correct value to be gotten.

3 0
1 year ago
The average adult (like Hank) is _________% water, ________% protein, _______% fat, _______% minerals, and _______% carbohydrate
Oliga [24]

Answer: 64% water, 14% protein, 16% fat, 4% minerals 1% carbohydrates

Explanation:

It’s what he says in the video

3 0
1 year ago
Taphonomists would probably conclude that hominins had scavenged meat from an animal carcass they did not kill if fossil animal
Oksanka [162]
Taphonomists would probably conclude that hominins had scavenged meat from an animal carcass, they did not kill if fossil animal bones; did not contain stone cut marks, which are easily distinguishable from tooth marks. 
Some characteristics that have distinguished hominins from other primates, living and extinct are their erect posture, bipedal locomotion, larger brains, and behavioral characteristics such as specialized tool use, and in some cases communication through language.<span />
4 0
1 year ago
Other questions:
  • Arianne recently traveled abroad where she enjoyed eating food from different countries and learning about different cultures. A
    13·2 answers
  • When cells are metabolically active but not dividing, they are in the ________ phase. when cells are metabolically active but no
    12·2 answers
  • Earth's axis of rotation is almost parallel to the plane of its orbit. Please select the best answer from the choices provided T
    5·2 answers
  • What is part of the third step in troubleshooting a computer problem?
    5·2 answers
  • Carbohydrates on the surface of leukocytes play an important role in responding to infection or inflammation. Place the followin
    9·2 answers
  • g"In the β-pleated sheet secondary structure of a protein, two or more amino acid sequences in separate parts of the protein are
    9·1 answer
  • Many scientists predict stronger storms, warmer oceans, and lower ocean pH in the future. If this occurs, how do you think these
    11·1 answer
  • Sonny took 16 seconds to finish a 100 m race . what was sonny 's average speed in the race ? give your answer decimal form
    10·1 answer
  • Schwann stated that all animals are made of cells, but animals are made of many different types of cells. For example, there are
    11·1 answer
  • 1. This is one structure essential in propagating young trees
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!