answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
2 years ago
6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequen

ce
5’ agcgggatgagcgcatgtggcgcataactg3’

3’ tcgccctactcgcgtacaccgcgtattgac5’
Biology
1 answer:
kati45 [8]2 years ago
5 0
This is the DNA. I'm going to only use the upper strand to demonstrate what this strand would code for before and after a single bp deletion (so write it as mRNA). I will also write it how it's easier to see this which is to split them up into the 3 base codon system. Note that you don't need to know the amino acid code - you use a table to find these.

ORIGINAL (mRNA on top, Amino Acid (AA) on bottom:

5'-AGC GGG AUG AGC GCA UGU GGC GCA UAA CUG-3'
    SER  GLY  MET SER ALA  CYS GLY ALA  STOP LEU 

Note that the protein would stop being made at the stop codon and the LEU wouldn't matter at the end...

Now, I will remove one bp...(I bolded it up top). Rewrite the mRNA and find the corresponding AA...

NEW
5'-AGC GGG AUG GCG CAU GTG GCG CAU AAC UG-3'
   SER  GLY  MET  ALA  HIS   VAL  ALA   HIS  ASN .....

Completely different amino acid sequence after the methionine (MET). The stop codon is gone...the protein would continue being translated until it reaches another stop codon...so not what was supposed to be made! 
You might be interested in
Many plants have leaves and fruits have wax coatings. Some animals also have wax-coated fur or feathers. In which class of biomo
Svetradugi [14.3K]

Answer:

1) Wax belong to lipids.

2) <u>Animals</u>: Water and cold isolation and protection from pathogenic microorganisms.

   <u>Plants</u>: It controls evaporation and maintains hydration.

Explanation:

1) Wax belong to the biomolecules of lipids.

2) In animals, such as birds, the uropygial gland secrets sebum or wax, spreading it throughout the animal's feathers to prevent water from penetrating as it serves as an isolating compound for animals that live in cold areas. It also provides protection from bacteria and fungi. In coloquial terms, it would be like a water-proof coat that protects them from water and extreme climate.

In plants, the secretion of wax through the cuticle has been developed as an adaptation to control evaporation and maintain hydration.

5 0
2 years ago
The cell shown above is forming a cleavage furrow as the first stage of cytokinesis. To which organism does the cell pictured li
spin [16.1K]
Can you please upload the photo referred to in the question, so that the organism can be identified? :)

3 0
2 years ago
Read 2 more answers
Relative to rainfall, the tundra is most like what other biome
11Alexandr11 [23.1K]
Alpine tundra occurs in mountains worldwide. The flora of the alpine tundra is characterized by dwarf shrubs close to the ground.
7 0
2 years ago
If you ingest carbon in the form of sugar, that carbon is released from your body as a ‘waste product' of the kreb's (citric aci
Lubov Fominskaja [6]
The waste product is CO2, or carbon dioxide.
8 0
2 years ago
Relatively large areas of land and water ecosystems are needed to provide the resources used by a typical American, as identifie
crimeas [40]

This indicator is an estimate of the amount of space on the earth that an individual uses in order to survive using existing technology. This space includes the biologically productive land and water area that produces the resources consumed by that individual such as food, water, energy, clothing, and building materials. It also includes the amount of land and water required to assimilate the wastes generated by that person. In other words, the ecological footprint measures a person's demand on the bio-capacity of the Earth.

7 0
2 years ago
Other questions:
  • Grains, seeds, nuts and root vegetables are examples of _________ carbohydrates and they take a __________ amount of time to bre
    10·2 answers
  • What is the benefit of an uneven production of gametes in oogensis?
    11·2 answers
  • Proteins, large complex molecules, are major building blocks of all living organisms. Discuss the following in relation to prote
    11·1 answer
  • Judith is receiving messages in her brain from baroreceptors in her stomach, from chemoreceptors detecting PO2 levels in her blo
    11·1 answer
  • Scenario where a cell may need to perform a form of endocytosis
    14·1 answer
  • The cheetah population was around 100,000 in 1900. Today, fewer than 12,000 cheetahs remain. What type of natural resource are c
    5·2 answers
  • Alika finds a certain kind of butterfly near her house. She reads that ultraviolet light is absorbed by the butterfly's wings, r
    9·1 answer
  • Which of the following best describes how cleaning products like chlorine, hydrogen peroxide, and soap influence the infectious
    10·1 answer
  • Water evaporates from a lake. Arrange the next steps of the water cycle in the correct order.
    14·2 answers
  • Butterflies can produce hundreds of offspring per cross. In a certain variety of butterflies, a maternally-imprintable gene is r
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!