answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
2 years ago
6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequen

ce
5’ agcgggatgagcgcatgtggcgcataactg3’

3’ tcgccctactcgcgtacaccgcgtattgac5’
Biology
1 answer:
kati45 [8]2 years ago
5 0
This is the DNA. I'm going to only use the upper strand to demonstrate what this strand would code for before and after a single bp deletion (so write it as mRNA). I will also write it how it's easier to see this which is to split them up into the 3 base codon system. Note that you don't need to know the amino acid code - you use a table to find these.

ORIGINAL (mRNA on top, Amino Acid (AA) on bottom:

5'-AGC GGG AUG AGC GCA UGU GGC GCA UAA CUG-3'
    SER  GLY  MET SER ALA  CYS GLY ALA  STOP LEU 

Note that the protein would stop being made at the stop codon and the LEU wouldn't matter at the end...

Now, I will remove one bp...(I bolded it up top). Rewrite the mRNA and find the corresponding AA...

NEW
5'-AGC GGG AUG GCG CAU GTG GCG CAU AAC UG-3'
   SER  GLY  MET  ALA  HIS   VAL  ALA   HIS  ASN .....

Completely different amino acid sequence after the methionine (MET). The stop codon is gone...the protein would continue being translated until it reaches another stop codon...so not what was supposed to be made! 
You might be interested in
Over 90% of all parasympathetic fibers are derived from cranial nerves ________. v (trigeminal) vii (facial) x (vagus) xii (hypo
Natasha2012 [34]
Over 90% of all parasympathetic fibers are derived from the cranial nerve X, which is the vagus nerve. 
The vagus nerve influences most organs below the neck. The activation of this nerve affects heart rate, blood pressure, production of stomach acid, movement of food through the intestines and breathing. 
8 0
1 year ago
Match the following vocabulary words. 1.ciliary musclesA transparent liquid which is located between the cornea and iris. 2.opti
klio [65]

Answer:

1. Aqueous humor.

2. Ciliary muscles.

3. Cone.

4. Cornea.

5. Iris.

6. Optic nerve.

7. Photoreceptor.

8. Retina.

9. Rod.

10. Sclera.

11. Vitreous humor.

Explanation:

A sensory system can be defined as components of the central nervous system (CNS) which comprises of the brain, neural tissues or pathways and sensory neurons responsible for sensory functions, perception and processing sensory informations such as sound, light, heat, etc.

Basically, the central nervous system (CNS) interprete the neural signals that are generated from stimuli that are detected by the sensory system. The five (5) main sense organs in the sensory system are: skin, tongue, ears, nose and the eyes.

An eye can be defined as a specialized organ of sight with the capability to receive visual images that are subsequently transduced into neural signals and relayed to the brain for processing and interpretation. Some of the components of the human eye matched with their description are;

1. Aqueous humor: a transparent liquid which is located between the cornea and iris.

2. Ciliary muscles: muscles attached to the lens to change its shape.

3. Cone: a photoreceptor cell which functions best in bright light. It detects color.

4. Cornea: the transparent portion of the sclera at the front of the eye.

5. Iris: a special part of the choroid layer composed of colorful tissue.

6. Optic nerve: the nerve connecting the eye to the brain.

7. Photoreceptor: specialized cells located in the retina that receive light images.

8. Retina: a delicate light-sensitive membrane covering the inside of the eyeball.

9. Rod: a photoreceptor cell which is sensitive to dim light, but detects no color.

10. Sclera: a fibrous material surrounding the eye to give it shape.

11. Vitreous humor: a transparent jellylike substance filling the eyeball.

8 0
1 year ago
Read 2 more answers
Herbicides are chemicals used to kill or inhibit the growth of unwanted plants and weeds. Many herbicides work by blocking elect
e-lub [12.9K]

Answer:

Oxygen.

Explanation:

Oxygen molecule that is produced in the light dependent reactions. This shutting down of linear electron flow greatly affected the production of oxygen. Photosystem II gains replacement electrons from splitting of water molecules into hydrogen ions (H+) and oxygen atoms so if the electron flow is disturbed then oxygen production is greatly affected.

3 0
2 years ago
Coach Damien notices that some of his football players drink more water than others before Friday night games. He is interested
max2010maxim [7]

The independent variable is the amount of water consumed by the football players.

The dependent variable is the football players' endurance, measured by how many times they can run up and down the bleachers before catching their breaths.

The coach's hypothesis was that the more water consumed, the more endurance the players will have.

There is not a control group present in this experiment, but it would be the set of players who did not drink a bottle of water before practice.

The experimental group is the set of players who did drink a bottle of water before practice.

The constants in the experiment are the operational definitions of endurance (how he measures their endurance), the amount of water each player drinks throughout the week, and the players used in the experiment.

The lack of a set control group poses a threat to the accuracy of the experiment's results.

6 0
1 year ago
Read 2 more answers
What type of weathering can be considered the "rusting" of rock?
In-s [12.5K]
Hello,

Chemical weathering can be considered by the "rusting of rock". 

Weathering can be described of the breaking down of rocks and other materials on the Earth's surface. There are three types of weathering: mechanical, chemical, and biological. Mechanical weathering is the type of weathering in which rock is physically broken into smaller pieces. Chemical weathering is the type  of weathering in which chemical changes break down rock. Biological weathering is the type of weathering in which animal, plant, and microbes means weaken and or disintegrate rock. 


Faith xoxo

5 0
2 years ago
Other questions:
  • What is the most likely homeostatic reason for developing a fever
    11·1 answer
  • What did researchers discover about the genetic mutation causing the loss of pelvic spines?
    14·1 answer
  • Eliana cuts a watermelon into several slices. Which statement best describes the physical change?
    10·2 answers
  • Which photoreceptor cells respond to the longest wavelengths of light, ranging from approximately 500-700 nm?
    8·1 answer
  • Sophie visited a museum and came across a very small marine invertebrate worm. The information plaque mentioned that the worm ha
    7·2 answers
  • Chrysanthemums are short-day plants that normally flower in late fall. Suppose you were a chrysanthemum grower and you would lik
    15·1 answer
  • With the endosymbiotic hypothesis in mind, what structure within modern-day chloroplasts is likely derived from the cytoplasm of
    9·1 answer
  • Which of the following describes the structure of albumin?
    9·2 answers
  • Reena segregates the waste at home and put the bio degradable waste in a pot containing soil. She leaves it for 15 days and uses
    10·1 answer
  • What is the elephant getting when the bond is broken in sucrose?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!