answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
2 years ago
6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequen

ce
5’ agcgggatgagcgcatgtggcgcataactg3’

3’ tcgccctactcgcgtacaccgcgtattgac5’
Biology
1 answer:
kati45 [8]2 years ago
5 0
This is the DNA. I'm going to only use the upper strand to demonstrate what this strand would code for before and after a single bp deletion (so write it as mRNA). I will also write it how it's easier to see this which is to split them up into the 3 base codon system. Note that you don't need to know the amino acid code - you use a table to find these.

ORIGINAL (mRNA on top, Amino Acid (AA) on bottom:

5'-AGC GGG AUG AGC GCA UGU GGC GCA UAA CUG-3'
    SER  GLY  MET SER ALA  CYS GLY ALA  STOP LEU 

Note that the protein would stop being made at the stop codon and the LEU wouldn't matter at the end...

Now, I will remove one bp...(I bolded it up top). Rewrite the mRNA and find the corresponding AA...

NEW
5'-AGC GGG AUG GCG CAU GTG GCG CAU AAC UG-3'
   SER  GLY  MET  ALA  HIS   VAL  ALA   HIS  ASN .....

Completely different amino acid sequence after the methionine (MET). The stop codon is gone...the protein would continue being translated until it reaches another stop codon...so not what was supposed to be made! 
You might be interested in
A plant leaf is an organ that traps light energy to make food. In what way is an animal stomach similar to a plant leaf? A. Both
lara [203]
Both organs are made up if several kinds of tissues. :D
4 0
2 years ago
Read 2 more answers
How is phosphorus transferred between animals and soil at N​
Dovator [93]

Phosphorus moves in a cycle through rocks, water, soil and sediments and organisms. Over time, rain and weathering cause rocks to release phosphate ions and other minerals. Once in the plant or animal, the phosphate is incorporated into organic molecules such as DNA. i hope this helped <3

8 0
2 years ago
Read 2 more answers
The building blocks of nucleic acids are ________.
jeyben [28]

Answer: The correct answer is nucleotide.

Explanation:

Nucleic acids are the polymer of nucleotides which are attached with each other with the help of phospho-diester bonds.

Nucleotide consists of sugar (ribose in RNA and deoxyribose in DNA), phosphate group, and nitrogenous base (A, T, G, and in DNA; and A, U, G, and C in RNA).

5 0
2 years ago
Imagine an artificial cell made with a selectively permeable membrane that allows water to pass through but does not allow sugar
kumpel [21]
The cell would shrivel. This is due to the fact that it would lose water to the surrounding 2% sugar solution through osmosis. The surrounding sugar solution is more concentrated hence hypertonic compared to the cell solution of 1%. Water, in osmosis, moves from a hypotonic solution to a hypertonic solution, through a semipermiable, until an isotonic balance is achieved.
5 0
2 years ago
Which statement best supports the argument that
Nadya [2.5K]

Answer:

C) a carbohydrate that takes longer to break down in the body puts less sugar into your bloodstream

Explanation:

Whole grains are a more complex carbohydrate than your basic white bread, meaning it takes longer to break down and doesn't flood your bloodstream with sugar the way white bread does when eaten. (also, the other three are not very closely related to/answer the question)

7 0
2 years ago
Other questions:
  • Can ells spontaneously appear without genetic material from previous cells
    5·1 answer
  • If 84 J of work are exerted to pull a wagon, how much force does it take to pull the wagon 7.0 m? Round your answer to the neare
    8·2 answers
  • Predict what the results would be if mrna were radioactively labeled instead of polypeptides
    8·1 answer
  • A client with vesiculopustular lesions with honey-colored crusts on the face visits a primary healthcare provider. which bacteri
    9·1 answer
  • In this diagram of a long bone, which type of bone marking is circled?
    14·2 answers
  • Which of the following is not a negative consequence of upward urban growth? a. pollution b. creation of a “heat island” c. incr
    5·2 answers
  • Read the following paragraph. Then rewrite it to make it represent good human relations skills.
    5·1 answer
  • When using a light microscope to view a cell she obtained from scraping under her fingernails, Ms. () notices that the cell lack
    6·1 answer
  • Which portion of the brainstem serves as the relay center between the cerebrum and the cerebellum? a. The diencephalon b. The mi
    5·2 answers
  • In 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!