answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
2 years ago
8

One of the first Mendelian traits identified in humans was a dominant condition known as brachydactyly. This gene causes an abno

rmal shortening of the fingers or toes (or both). At the time, some researchers thought that the dominant trait would spread until 75 percent of the population would be affected (because the phenotypic ratio of dominant to recessive is 3:1).
Why was this reasoning incorrect?

A. Rare alleles tend to remain rare even when they are dominant so the dominant trait would spread until 25 percent of the population would be affected.
B. The distribution of a gene among individuals is determined by mating and environmental factors, so only a recessive trait can spread until 75 percent of the population would be affected.
C. Rare alleles tend to remain rare even when they are dominant.The distribution of a gene among individuals is determined by mating and environmental factors.
D. The frequency of an allele is determined only by migration, so it is impossible to determine the distribution of desease in human population using Mendelian crosses.
Biology
1 answer:
kvv77 [185]2 years ago
5 0

Answer:

The correct option is C. Rare alleles tend to remain rare even when they are dominant.The distribution of a gene among individuals is determined by mating and environmental factors.

Explanation:

Most people believe that a rare allele would only be recessive. But this is not correct. A rare allele can be dominant. The frequency of an allele to occur in a population will depend on the environmental factors. The alleles which code for traits that are best suitable for living in an environment will be seen in more abundance. The frequency of an allele to occur in a population also depends on the breeding trends of the population.

You might be interested in
Assuming that you had an agonist and an antagonist for every autonomic transmitter receptor, how could you determine which recep
dsp73

The correct answer is by using the antagonist.

The antagonist is a molecule that blocks a biological response by binding to the receptor. So, you add antagonists to the receptors you want to determine and see which antagonist blocked the response. By blocking the specific response you can get the answer what receptor it was.

7 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Which of the following does NOT describe bacteria? They help break down dead organic material so it can be recycled into a usabl
vovangra [49]
I think the correct answer would be the third option. Organisms that help break down dead organic material so it can be recycled into a usable form for other organisms are called decomposers and this would include some of the bacteria. Also, there is a number of bacteria that are capable of breaking down some of the harmful products like in recent studies there are bacteria that could dechlorinate the toxic PCB substance. Some bacteria, as well, lives in the human intestines which aids in the breaking down of the food into useful molecules. The third option is partially true since there are some bacteria like the cyanobacteria which produces oxygen but it does not contribute largely to the oxygen present in the atmosphere.
8 0
2 years ago
The _______ system breaks down the food we eat, while the _______ system transports the tiny food particles to each cell in the
Mrac [35]
The digestive system breaks down the food we eat while the circulatory system transports the tiny particles to each cell in the body.
4 0
2 years ago
Most ocean-water usage is for _____. mining industry desalination power plants
Dmitry [639]
The answer is Desalination. Desalination is the process of removing minerals from salt water. Most ocean-water consumption and supply are most likely to be very particular in this places like USA, Europe, Africa and UN. Desalination depends on the capacity and facility of the place.
6 0
2 years ago
Read 2 more answers
Other questions:
  • Mutations within an organism can occur in body cells or reproductive cells. Which type of mutation is seen in a sperm cell but n
    5·2 answers
  • "On the Mode of Communication of Cholera" was a scientific text written by Dr. John Snow in 1855 about the disease cholera. Iden
    8·2 answers
  • Pros and cons of canopy fogging
    11·1 answer
  • The unequal heating of Earth occurs because at the_____, more solar energy is received than is radiated back to space, and at th
    12·1 answer
  • How did the backyard bird feeders in the article increase competition in that ecosystem?
    14·1 answer
  • A teacher has asked four students to state a scientific theory. Which student is correct? Student Theory Antonio Mixing baking s
    8·2 answers
  • A key point in Darwin’s explanation of evolution is that Group of answer choices1. the biological structures most likely inherit
    9·1 answer
  • Which statement describes the ability of the cell membrane to allow various substances to move tbrough it?
    14·1 answer
  • Your roommate tells you that because she has no time to eat healthy foods, she is taking megadoses of vitamins. You warn her tha
    15·2 answers
  • Petra finds a discolored stain on the carpet at a suspected crime scene. What two presumptive tests might she use to determine i
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!