The correct answer is by using the antagonist.
The antagonist is a molecule that blocks a biological response by binding to the receptor. So, you add antagonists to the receptors you want to determine and see which antagonist blocked the response. By blocking the specific response you can get the answer what receptor it was.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
I think the correct answer would be the third option. Organisms that help break down dead organic material so it can be recycled into a usable form for other organisms are called decomposers and this would include some of the bacteria. Also, there is a number of bacteria that are capable of breaking down some of the harmful products like in recent studies there are bacteria that could dechlorinate the toxic PCB substance. Some bacteria, as well, lives in the human intestines which aids in the breaking down of the food into useful molecules. The third option is partially true since there are some bacteria like the cyanobacteria which produces oxygen but it does not contribute largely to the oxygen present in the atmosphere.
The digestive system breaks down the food we eat while the circulatory system transports the tiny particles to each cell in the body.
The answer is Desalination. Desalination is the process of removing minerals from salt water. Most ocean-water consumption and supply are most likely to be very particular in this places like USA, Europe, Africa and UN. Desalination depends on the capacity and facility of the place.