answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
2 years ago
9

(Q005) Humans are unusual because our cultural practices can actually change our environmental circumstances. We can change the

environment in which natural selection acts on our traits. Describe how this process has played out in the evolution of adult lactose tolerance. Describe how this process has played out in the maintenance of the sickle-cell trait. Can you hypothesize any similar situations where our future evolution may be influenced by cultural practices we have today?
Biology
1 answer:
mel-nik [20]2 years ago
7 0

Answer:

sickle cell disease or sickle cell disease is about the inheritance of metaplastic cells or cells that do not respect normal cell morphology from the mother or father to a child.

This is not associated with cultures, instead lactose tolerance is.

Explanation:

Lactose tolerance is basically an adaptation of the body in those humans who continue to drink milk throughout their lives, once the growth stage is over, milk should be suspended, although some continue to consume it and lactase continues to be encoded and expressed.

Some people for cultural reasons or environmentalist lifestyles do not drink animal milk, but rather vegetable milk.

You might be interested in
Biological augmentation is a process that _________. answer correct uses organisms to detoxify polluted ecosystems use organisms
nikdorinn [45]
Biological augmentation is a process that uses organisms to add essential materials to a degraded ecosystem. It involves the addition of archaea, or bacteria cultures required to speed up the rate of degradation of a contaminant, this is supplementation application of non-toxic, natural, beneficial microbes, enzymes and minerals to enhance the rate of degradation.
3 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
which statement correctly compares and contrast the three stages of cellluar respiration that occurs in the presence of oxygen
Lapatulllka [165]
<h2><u>Full Question:</u></h2>

Which statement correctly compares and contrasts the three stages of cellular respiration that occur in the presence of oxygen? Each stage occurs in the mitochondria, but only the final stage produces ATP. Each stage produces ATP, but only the third stage occurs in the mitochondria. Each stage produces ATP, but only the first stage occurs in the cytoplasm. Each stage occurs in the cytoplasm, but only the final stage produces ATP.

<h2><u>Answer</u>:</h2>

Each stage produces ATP, but only the first stage occurs in the cytoplasm.

<h3><u>Explanation</u>:</h3>

Cellular respiration is the process by which the glucose or any respiratory substrate is burned down inside a cell producing ATP or energy. This process of cellular respiration is seen in each and every living cell. The glucose is burned in the cytoplasm of the cell producing the pyruvate. This pyruvate is decarboxylated into Acetyl CoA and transferred inside the mitochondria. So the glycolysis or the 1st step of cellular respiration occurs in cytoplasm and rest inside the mitochondria.

ATP is produced from each astep of cellular respiration. So the correct option is option C.

4 0
2 years ago
How does a high protein diet benefit someone like tara after a major surgery or serious hospitalization?
sattari [20]

Answer:

It helps the body regain iron from the blood loss that occurs during a surgery. Hope this helps :)

8 0
2 years ago
Which statement describes the semiconservative model of DNA replication correctly? It proposes that the two nucleotide strands u
arsen [322]

Answer: It proposes that the entire double‑stranded DNA molecule serves as a template for a whole new molecule of DNA.

Explanation:

In semi-conservative DNA replication:

- a parent double-stranded DNA splits in two.

- Each strand serves as template, and then read by the enzyme, DNA polymerase, to ensure accurate synthesis of a new daughter strand for both

- the newly synthesized strand contains nucleotides that are complimentary to free nucleotides present in the parent strand.

Thus, because the parent double strand is retained in the newly synthesized DNA, this model is described as semi-conservative

5 0
2 years ago
Read 2 more answers
Other questions:
  • A population of giraffes on a square kilometer of the African savannah contains sixteen individuals. Generally, the giraffes sta
    10·2 answers
  • When lightning appears in the remote distance and appears to produce no thunder sound, it is called _____?
    12·1 answer
  • A breakfast cereal advertises that it contains essential vitamins and minerals. In this context, the word "essential" means ____
    8·1 answer
  • (01.04 LC)
    5·2 answers
  • A researcher discovers a new unicellular organism that contains a single circular chromosome and no membrane-bound organelles. U
    13·1 answer
  • 1. What is different about the rock formations in the Rocky Mountains and Great Plains? Explain
    12·1 answer
  • Which of these limiting factors could cause tree squirrels to lose their homes?
    11·2 answers
  • Some liquid is collected from the xylem in the stem of a plant.
    7·1 answer
  • When the concentration of solute is the same throughout a system, the system has reached ....?
    6·1 answer
  • Daisy went on vacation with her family last summer. Daisy and her family traveled by water from high in the mountains all the wa
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!