All categories

2 years ago

Greedy Reassembly Algorithm:

Biology

1 answer:

Ierofanga [76]2 years ago

6 0

Answer:

The answer is explained below

Explanation:

The greedy reassembly algorithm is used to assembles the reads into the correct DNA sequence.

Solution:

The first step is to see the longest prefix that is the suffix of the other string is of length 11:-

AGCTGTTTTCGTT and CTGTTTTCGTTA

After combining these two we get:

AGCTGTTTTCGTTA

Next we take is of length 8:

TTTCGTTATACAT and AGCTGTTTTCGTTA

After combining these two we get:

AGCTGTTTTCGTTATACAT

Next we take is of length 7:

TATACAT and AGCTGTTTTCGTTATACAT

We can get :

AGCTGTTTTCGTTATACAT

Next we take is of length 7 again:

CACTCCATTTTA and CATTTTAGCTGTT

After combining these two we get:

CACTCCATTTTAGCTGTT

After, this we will only be left with 2 strings:

CACTCCATTTTAGCTGTT and AGCTGTTTTCGTTATACAT

We take the length 7 again:

The final string will be:-

CACTCCATTTTAGCTGTTTTCGTTATACAT

You might be interested in

Which of the following is a true statement?

FrozenT [24]

Answer:

a. Anabolic pathways build molecules, require energy, and are endergonic.

Explanation:

Anabolic pathway describes the metabolic reactions that build up complex molecules from simpler ones, typically via condensation (monomers covalently joined producing water as a by-product). It requires energy to construct new bonds, this means is endergonic.

The catabolic pathway, on the other hand, describes metabolic reactions that break complex molecules down into simple ones, typically via hydrolysis (consumption of water to break bonds within the polymer). It releases energy when these bonds are broken, this means it is exergonic.

Considering this information we can conclude that the correct answer is a. Anabolic pathways build molecules, require energy, and are endergonic.

I hope you find this information useful and interesting! Good luck!

5 0

2 years ago

Which of these conditions indicate positive feedback has occurred?

aleksklad [387]

Answer;

A) Blood pressure decreases greatly; blood flow to the heart is inadequate, and blood pressure decreases.

Explanation;

-With negative feedback, the output reduces the original effect of the stimulus. While in a positive feedback system, the output enhances the original stimulus.

-Negative feedback is the most commonly used feedback loop in the body. Negative feedback is used to negate or counteract a stimulus without completely eradicating it.

-One key difference between the two feedback is that positive feedback loops are used to eradicate a stimulus. Another key difference is that responses through positive feedback become more amplified over time. So once a stimulus activates a positive feedback loop it is not turned off until the stimulus is completely removed.

8 0

2 years ago

Imagine that a doctor is culturing two types of cells: one from a malignant melanoma and one from a normal skin sample. How woul

Lynna [10]

Answer:

Malignant melanoma cells would have active telomerases that constantly replenish and lengthen telomeres.

Explanation:

Telomerase can be described as enzymes which add the repetitive sequences called telomeres at the end of a chromosome. Telomeres can be described as repetitive sequences at the end of the chromosome which are involved in protecting the chromosome from any damage.

In a normal skin cell, the telomeres will shorten with time. But in a malignant skin cell, the telomerase will add the repetitive sequence again and again. The telomers will not be able to shorten.

5 0

2 years ago

Why do wilting of leaves take place in hot summer days?

LenKa [72]

Water escapes from the pores in plant leaves because of evaporation. This water is what keeps the vacuoles in the cells full and shaped, so the vacuoles are like deflating water balloons

7 0

2 years ago

Read 2 more answers

Step 8: Simulate an environment with equal amounts of insects and seeds, but no fruit. Which flock will be able to eat the most?

defon

The omnivorous flock will eat the most as it eats both insects and seeds. With the removal of fruit it will not be affected much.

The herbivorous flock will eat the least as it has the option to eat seeds only after the removal of fruit.

Explanation:

Let us take the example of Finches. Finches have many different species with different variations adaptable to conditions favorable as per availability of the type of food.

Lets say -

Species X and Y is provided with insects, seeds and fruit.

Species X - Omnivorous

Species Y - Herbivorous

The species X will be able to eat the most as it is an Omnivore.

The omnivorous flock will eat the most as it eats both insects and seeds. With the removal of fruit it will not be affected much.

Species Y will be able to eat the least as it is an herbivore.

The herbivorous flock will eat the least as it has the option to eat seeds only after the removal of fruit.

6 0

2 years ago

Read 2 more answers