In biological systems, the chemical reactions concerning glucose and ATP as a product are vital for cellular respiration and photosynthesis. Shortcuts reduce the activation energy, which increases the net "gain" of products. I would go with the last one.
Answer:
<u><em>The correct option is C) genetic variation</em></u>
Explanation:
Genetic variation can be described as the differences present in the genetic material i.e DNA of organisms present in a population. Genetic diversity allows organisms of a species to better adapt to an environment. A population in which the genetic variability is scarce might become wiped out by a disease or an invading predator.
As the birds show different variations hence the term that best described them is genetic variation.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
<span>Gyri
and sulci are the folds and grooves,
respectively, which characterize the surface of the human brain.</span> Gyri
are part of the brain that shows a larger surface of the brain. When the gyri
change in structure or form it shows that a body is encountering sickness and
disorders. Sulci is one of the part of the cerebral cortex that surrounds the
gyri.
Answer:
concept training
Explanation:
Based on the scenario being described within the question it can be said that Judy is engaging in concept training. In the concept of Psychology, this term refers to when a researcher provides the subject certain objects in order for the subject to learn how to classify each object, by being shown examples and rewarded for making the correct distinction.
