Answer:In many ways, meiosis is a lot like mitosis. The cell goes through similar stages and uses similar strategies to organize and separate chromosomes. In meiosis, however, the cell has a more complex task. It still needs to separate sister chromatids (the two halves of a duplicated chromosome), as in mitosis. But it must also separate homologous chromosomes, the similar but nonidentical chromosome pairs an organism receives from its two parents.
Explanation:Mitosis(Opens in a new window)(Opens in a new window) is used for almost all of your body’s cell division needs. It adds new cells during development and replaces old and worn-out cells throughout your life. The goal of mitosis is to produce daughter cells that are genetically identical to their mothers, with not a single chromosome more or less.
Meiosis, on the other hand, is used for just one purpose in the human body: the production of gametes—sex cells, or sperm and eggs. Its goal is to make daughter cells with exactly half as many chromosomes as the starting cell.
To put that another way, meiosis in humans is a division process that takes us from a diploid cell—one with two sets of chromosomes—to haploid cells—ones with a single set of chromosomes. In humans, the haploid cells made in meiosis are sperm and eggs. When a sperm and an egg join in fertilization, the two haploid sets of chromosomes form a complete diploid set: a new genome.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
B.
the inability of the penis to become erect
Explanation:
The two main plant tissue that works together to release sugar and carry hormones so that reproduction can take place are: The ground and the vascular tissue.
Answer:
B) Wait and see what happens to the plant.
Explanation:
Let it be in the sunlight for a few days to see if it gets greener or grows. Sunlight is an important part in photensynthesis, which is the process that plants create their food source: glucose. They need it to grow.
