Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Please mark brainliest
Explanation:
Yes, because geraniums live on land that has a temperature of 65 degrees F and 70 degrees F.
PLEASE MARK BRAINLIEST
The right answer is: Leptin
.
Leptin is a hormone closely linked to the regulation of energy consumption and expenditure: appetite, metabolism, and hunger.
A hormone is a protein with a messenger function. This means that once released into the bloodstream, she goes to another part of the body to transmit a message to specific receptors.
Leptin is manufactured in white adipocytes (adipose tissue) where triglycerides (fats) are stored and acts on the hypothalamus.
Answer:
D) The virus has entered the genome of the bacterial cell and is in the lysogenic stage.
Explanation:
Virus have two reproductive cycle lytic and lysogenic cycles. In the lytic cycle, the viral genome is expressed using the host molecular machinery and make capsid proteins. These capsid proteins surround the viral genome and make new phages which lyse the host cell and gets released.
After the release, they enter their genome in other host and that genome first incorporates in the host genome and replicates with the host genome. This cycle is called the lysogenic cycle and in this cycle lysis of cell does take place because no new phages are produced in it.
Answer:
Small head
Explanation:
Since the genes are located in the nucleus of a cell which has being removed (but some genes are still located in the mitochondria of the ocyte) from its ocyte to fuse it with with another nucleus. Since the cell follows a maternal inheritance of gene, it would have a small head because of the presence genes in the mitochondria.
