answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
2 years ago
8

PLS HELP ASAP WILL MARK BRAINLIEST!

Biology
1 answer:
katrin2010 [14]2 years ago
7 0

For anyone taking this test, Salinity Levels is incorrect and Product 1 because it is presumed to be more effective at removing plastic is incorrect,

You might be interested in
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Emma lives in Wisconsin and wants to plant geraniums in her yard. The average daily temperature in her area is 21°C (70°F) and t
liraira [26]

Answer:

Please mark brainliest

Explanation:

Yes, because geraniums live on land that has a temperature of 65 degrees F and 70 degrees F.

PLEASE MARK BRAINLIEST

7 0
2 years ago
Jorge, who just finished a large dinner an hour before, is offered a slice of pizza by his roommate. jorge says, "no thanks. i'm
Klio2033 [76]

The right answer is: Leptin .

Leptin is a hormone closely linked to the regulation of energy consumption and expenditure: appetite, metabolism, and hunger.

A hormone is a protein with a messenger function. This means that once released into the bloodstream, she goes to another part of the body to transmit a message to specific receptors.

Leptin is manufactured in white adipocytes (adipose tissue) where triglycerides (fats) are stored and acts on the hypothalamus.

5 0
2 years ago
Read 2 more answers
When a virus infects a bacterial cell, often new viruses are assembled and released when the host bacterial cell is lysed. If th
Andreas93 [3]

Answer:

D) The virus has entered the genome of the bacterial cell and is in the lysogenic stage.

Explanation:

Virus have two reproductive cycle lytic and lysogenic cycles. In the lytic cycle, the viral genome is expressed using the host molecular machinery and make capsid proteins. These capsid proteins surround the viral genome and make new phages which lyse the host cell and gets released.

After the release, they enter their genome in other host and that genome first incorporates in the host genome and replicates with the host genome. This cycle is called the lysogenic cycle and in this cycle lysis of cell does take place because no new phages are produced in it.

4 0
2 years ago
Let’s suppose a sheep that provided the oocyte for reproductive cloning was homozygous for a gene that causes a small head. This
Misha Larkins [42]

Answer:

Small head

Explanation:

Since the genes are located in the nucleus of a cell which has being removed (but some genes are still located in the mitochondria of the ocyte) from its ocyte to fuse it with with another nucleus. Since the cell follows a maternal inheritance of gene, it would have a small head because of the presence genes in the mitochondria.

3 0
2 years ago
Other questions:
  • Viruses are made up of either DNA or RNA surrounded by a coating of protein. when the two main substances that make up a virus a
    10·2 answers
  • Plants that live on the floor of forests tend to have much larger leaves than plants that live in hot, sunny conditions. offer a
    9·2 answers
  • Describe how you could simulates one of the cases from the computer simulation (Case 2, Case 3, or Case 4) using the basic labor
    15·1 answer
  • Which would most likely cause a decrease in numbers of woodpeckers in ecosystem
    9·1 answer
  • Mrs. O’Grady wants to know if doing labs with her science class really helps them learn the material better. She decides to test
    13·2 answers
  • When biological membranes are frozen and then fractured, they tend to break along the middle of the bilayer. The best explanatio
    11·1 answer
  • Who are the husband and wife depicted in these Byzantine mosaics, and what religious sacrament are they celebrating?
    8·1 answer
  • When a partially rotted log was turned over, mushrooms, termites, pill bugs, ants, slugs and earthworms were found to be living
    11·1 answer
  • 15. Sarah is a biologist who is studying a species of crab. In the wild, crabs with larger
    8·1 answer
  • Strawberry DNA Extraction lab What was the purpose of the Sodium Chloride? Include a discussion of polarity and charged particle
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!