Answer:
B: I saw it an hour ago and I didn't want to answer because there are too many ifs. I tried, but it could be wrong.
Explanation:
This is not as simple as it sounds and I have a feeling that the correct answer is in the head of the person designing the question. In other words, I could easily get it wrong.
It depends on whether the tide is going in or going out to start with. The question would be a whole lot easier if the bottle was dropped miles from shore.
A: The bottle is capped. A is certainly not true. The low density of the bottle will keep it afloat until something happens that determines it's permanent direction. Not A.
B: It will if nothing else influences it. There will always be waves around that will insure an up and down movement. This is a possible answer, but not a certain one. A five year old could not throw it very far to start with. Let's read the rest.
C: Maybe. It has happened. The bottle needs a good start and the tide going out to happen. Let's read the last 2.
D: Not in a million. Not D.
E: It won't be still. The ocean is always moving. Not E.
I'm going to pick B, but it is not a slam dunk.
Answer:
The correct answer that best fits the result of my investigation is Thermoregulation energy cannot be created or destroyed,it can only be transformed .Therefore if ATP is not generated from glucose and the energy is transformed into heat.
Explanation:
DNP or dinitrophenol act as uncoupler of oxidative phosphorylation when means it prevents the coupling of electron transport chain to oxidative phosphorylation.As a result electron transport occurs resulting in the generation of energy but the so formed energy is utilized to generate rather than ATP formation.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Scientists might replicate a strand of DNA using PCR before sequencing it. Once the sequence is known, they can produce a corresponding gene probe
Explanation:
PCR refers to the polymerase chain reaction that amplifies the small sample of DNA into multiple copies in three steps. These steps are denaturation of sample DNA to produce single-stranded template strand, binding of primer to the template and elongation. The multiple copies of the sample DNA are then used to decipher its sequence using various sequencing methods.
Once the sequence of the sample DNA is known, the short, single-stranded DNA molecules that are complementary to the specific sequence of DNA are formed. These single-stranded DNA molecules are called DNA probe and are used to detect the specific nucleotide sequence in some other sample DNA.
D.
variable-ratio schedule of reinforcement.
