answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Schach [20]
2 years ago
8

A prokaryote is most likely to use which of the following modes of metabolism to release energy if it is in an environment witho

ut oxygen, dies when exposed to oxygen, and uses fermentation? A. Obligate anaerobe B Heterotroph C. Facultative anaerobe D. Photoautotroph
Biology
2 answers:
Anni [7]2 years ago
5 0
It's letter A - Obligate anaerobe.

<em>Obligate anaerobes</em> are microorganisms killed by normal atmospheric concentrations of oxygen. A <em>facultative anaerobe</em> prefers to produce energy in the presence of oxygen but can survive without it. <span>A <em>photoautotroph </em>is an organism that converts light energy into chemical energy. </span><span>Prokaryotes may perform </span>aerobic<span> (oxygen-requiring) or </span>anaerobic<span> (non-oxygen-based) metabolism and some can switch between these modes. Since we're talking about an environment without oxygen and dies when exposed to oxygen, the preferable answer is A.</span>
Licemer1 [7]2 years ago
3 0

the answer is B. OBLIGATE anaerobe. it is the only one that is poisoned by oxygen. if you want to see for yourself just type into google (obligate anaerobe)  Took the test and got a 100% :)

You might be interested in
Light is made up of tiny bundles of energy called
MakcuM [25]
The name of the light that is made up of tiny bundles of energy is called Photons
The answer is B
5 0
2 years ago
Which property of epithelium enables it to form coverings and linings of the body?
Svetradugi [14.3K]

Answer:

The answer is squamous epithelium

Explanation:

5 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Which of the following could result in secondary succession?
AleksandrR [38]
The answer would be A
6 0
2 years ago
Read 2 more answers
Leonard designed a parallel circuit to light two lightbulbs. But his circuit doesn’t work. Which two items in the circuit must b
tamaranim1 [39]

In a parallel circuit, the voltage across each of the components is the same, and the total current is the sum of the currents through each component.

If two or more components are connected in parallel they have the same potential difference ( voltage) across their ends. The potential differences across the components are the same in magnitude, and they also have identical polarities. The same voltage is applicable to all circuit components connected in parallel.

If each bulb is wired to the battery in a separate loop, the bulbs are said to be in parallel.


8 0
2 years ago
Other questions:
  • There are several properties of water that make Earth a suitable environment for life, including water's high boiling point and
    8·1 answer
  • A diploid cell containing 32 chromosomes will make a haploid cell containing ___ chromosomes.
    10·1 answer
  • Cold medicines can_______.
    14·1 answer
  • The following statements are all true regarding amino acids and proteins. Select which statements are unique to proteins alone a
    13·1 answer
  • Describe the general diversity of species on Earth in terms of relative numbers and types of organisms. Compare known numbers to
    11·1 answer
  • Write a few sentences explaining whether the following theme from The Outsiders is universal: “People often struggle to fit in;
    7·2 answers
  • what is sequence of steps in photosynthesis how is it different in desert plants and those in temperate regions​
    7·1 answer
  • Which of the following digestive system structures releases sodium bicarbonate into the small intestine, resulting in a change i
    11·1 answer
  • A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N
    6·1 answer
  • In a dichotomous classification system, __________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!