Answer:
choanoflagellates and sponges are sister groups
Explanation:
The choanoflagellates are small unicellular organisms belonging to the Protista kingdom. These microorganisms are collared flagellates morphologically similar to the choanocyte cells of animal sponges, which have a central flagellum surrounded by a collar of microvilli. In consequence, it has been suggested that choanoflagellates may represent the closest living relatives of primitive metazoans (i.e., they are sister groups to sponges). This hypothesis has recently been supported by both molecular phylogenetic and comparative genomic analyses.
DDT stands for dichloro-diphenyl-trichloroethane. The first kind of synthetic/artificial insecticides came into use in the 1940s. The earlier usage of DDT include: a) Killing of malarial vectors, b) Combatting Typhus and other insect borne human diseases, c) As a pest control in crops d) as a pest control in garden, live stock production and even at homes.
The negative impact of DDT could be felt for the first time when the pests that were earlier killed by use of DDT have now become pesticides resistant. In the 1950s in USA, the regulatory measures were adopted to reduce the usage of DDTs as its effects as a pesticides were no more long significant and also it was creating detrimental physical and psychological impacts on the human and environment.
It was in 1972 that the U.S. Environmental Protection Agency cancelled the order for banning the usage of DDT based on the adverse impact it produced on the environment, human and other life forms. Since then continuous studies are being conducted to analyse the impact of DDTs. In some later years it was established that DDT is the cause of producing tumors in liver.
Some of the common negative impacts produced by DDT as per the U.S. Department of Agriculture :
a) The non destructive nature – DDT can not be destroyed and thus it remains persistent in the atmosphere
b) It attacks the tissues of living organisms especially the animals and humans ( fatty tissue)
c) It can penetrate the atmosphere to deeper extent.
Now as per the current stuation, The use of DDT is controlled and other alternatives of pest control organisms is being deduced. As per the treaty of Stockholm Convention on POPs (Persistent organic pollutants) , usage of DDT for malarial control is justified but it puts a restrictive use of DDT as pesticides in other areas.
Answer:
A) longer than
Explanation:
Connecting in series doubles the voltage while maintaining the same capacity rate of amps per hour.
Since the load is the same, the battery connected in series has better capacity and then tend to last longer with respect to the load carried.
Answer:
Convergent.
Explanation:
The collision between two lithosphere plates on the surface of earth results in the formation of convergent plate boundaries. The process of subduction occurs when one plate converges over the other plate.
The diagram given in the question shows the convergent plate boundary. The collision of two lithospheric plates have been represented in the picture.
Thus, the correct answer is option (A).
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
