Answer:
stages of the nitrogen cycle
1. Nitrogen-fixation
Legume plants such as peas, beans and clover contain nitrogen-fixing bacteria. These bacteria live in swellings in the plant roots called nodules. Nitrogen-fixing bacteria convert nitrogen gas from air into a form that plants can use to make proteins.
Free-living nitrogen-fixing bacteria are also found in the soil. When they die the nitrogen they have fixed into their biomass is converted into ammonium.
2. Feeding
Animals consume plant protein, digest it using specific enzymes and absorb the free amino acids.
3. Production of nitrogenous waste products
Animals cannot store excess protein in their bodies. They break it down and turn it into waste products and excrete them from their bodies.
4. Decomposition
Decomposers (some free-living bacteria and fungi) break down animal and plant proteins (from dead organisms) and nitrogenous waste products to release energy. As a result of decomposition nitrogen is released into the soil in the form of ammonium.
5. Nitrification
A group of free-living soil bacteria called nitrifying bacteria convert ammonium into nitrates in order to obtain energy.
6. Uptake of nitrates
Non-legume plants absorb nitrates from the soil into their roots and use the nitrates to produce their proteins.
7. Denitrification
This is when bacteria in the soil convert the nitrate back into nitrogen gas which then gets released back into the atmosphere.
Monomers are the basic units of larger molecules-macromolecules. These units are connected via chemical bonds and when joined in repetition, a polymer is formed.
Monosaccharides (simple sugars) are monomers that form complex sugars-polysaccharides (long chains of monosaccharides usually form the energy-storing molecules found in food) by creating glycosidic bonds. Those linkages vary widely in geometry (can be linear and branched). Besides that, monosaccharides can have different functions in the organism and monomers vary extensively (in the orientations of hydroxyl groups and in location).
Monomers of nucleic acids (deoxyribonucleic acid-DNA and ribonucleic acid-RNA) are nucleotides composed of a five-carbon sugar, a phosphate, and a nitrogenous base. Monomers of nucleic acids do not vary that much, there are only four different monomers that include adenine and guanine, which are derived from purine; and cytosine and thymine (for DNA) or uracil (for RNA), derived from pyrimidine.
The answer is a
hope this helps
I think the deficiency of dedicated respiratory and circulatory systems in Planarians does not cause a problem because none of their cells are far removed from the gastrovascular cavity or from the external environment. Planarians are free-living flatworms and form the class Turbellarians in the Phylum Platyhelminthes. Flatworms have three tissue layers, that is the ectoderm, mesoderm, and endoderm.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
