Answer:
The box will not move because balanced forces are acting on it.
Explanation:
According to Newton's first law of motion, an object will remain in its state of rest or motion along a straight line unless acted upon by an unbalanced force.
An unbalanced force is an individual force acting on any side of an object which is not balanced by a force of equal magnitude acting in the opposite direction.
From the image, two forces of equal magnitude of 10 N are pulling the 100 kg box in opposite directions. Since the two forces, 10 N each are pulling the object in opposite directions, they are balanced forces. Therefore, the box will not move because balanced forces are acting on it.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Any substance that has enhanced reactivity, or altered properties in the presence of light is said to be photoreactive. For example, a photovoltaic cell enables sunlight to be processed into usable electricity by exciting outer shell electrons on some metals. Photoreactive substances can either be natural, such as chlorophyll, or entirely man-made in the case of a photovoltaic cell.
<span>According to the ipat model, technology that enhances our acquisition of minerals, fossil fuels, timber, and ocean fish increase environmental impact.
IPAT is a model or equation which expresses that
I (stands for Environmental impact) is the product of three factors: P (stands for population), A (is affluence) and T ( for Technology).
IPAT can be written as (I=PAT) or I = pxAxT</span>
Answer: Individuals with a high concentration of cysteine in their urine, show symptoms of cystinuria.
Explanation:
Cystinuria is an hereditary and rare disease in which stones of an amino acid called cystine form mostly in the kidney but also in the ureter and bladder. This is a dimeric amino acid which is formed by two cysteine molecules linked by a disulfide bond. L-cysteine is a non-essential sulfuric amino acid found in a wide variety of foods, some of which are proteins. <u>This condition is passed from parents to children so it is hereditary, the person must inherit the defective gene from both parents. </u>
Cystinuria is caused when there is a high concentration of cystine in the urine. Normally, most cystine dissolves, enters the kidneys and returns to the bloodstream. <u>However, people with cystinuria have the genetic defect that interferes with this process. </u>This condition is due to a defective transport of cystine in the apical membrane of the intestinal epithelium and proximal renal tubule. The result is an absence of cystine reabsorption in the renal proximal tubule producing an excess of cystine in urine and with the consequent formation of kidney stones. Cystine stones are very difficult to remove by lithotripsy unlike the rest of the stones. Therefore, a non-invasive therapy should be carried out to prevent the recurrence of stone formation. This therapy would be based on a high intake of liquids, alkalization of urine, and use of chelating agents. In order to preserve kidney function, a combination of these three therapeutic measures is necessary to reduce both the recurrence and the morbidity of the disease.
