answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
2 years ago
11

This phylogenetic tree shows how scientists believe the Danes, Chinese, and Tibetans are related based on the analysis of many g

enes. Use the data about the EPAS1 alleles to add information to the tree. (Assume that there is no interbreeding between the different populations after the lineages split.) Labels can be used once or more than once.
Biology
1 answer:
Drupady [299]2 years ago
6 0

Answer:

Phylogenetic trees can be described as diagrams which represents the evolutionary histories of organisms. The organisms that share more common traits or functions are more closer to one another in the diagram.

The phylogenetic tree in the above diagram shows that the ancestors of Danes, Chinese and Tibetans carried the regular EPAS1 alleles.

According to the tree, the Chinese are more closer to the Tibetans as they carry the Tibetan EPAS1 alleles which the Danes do not carry.

You might be interested in
Write a message to Dr. Bayard Moraga explaining how the Museum of West Namibia’s exhibit should tell the story of the Mesosaurus
lara [203]

Answer:

period pooh sweetie

Explanation:

8 0
2 years ago
Calculate the average rate of change in corn yield from 1964 to 2008 (Round to the nearest whole number.)
Anna11 [10]

Answer:

In 1964 2.6 bales per hectare while in 2008, 380 bushels per hectare.

Explanation:

in 1964, the average corn yield was 2.6 bales per hectare which is equals to 570 kg per hectare while in 2008, the average yield of corn was 380 bushels per hectare which is equals to 9655 kg per hectare. This increase in the productivity of corn crop is due to advancement of technology, high yielding seed varieties and reduces post harvest losses. The yield of 2008 is 17 times higher than 1964.

3 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
When an earthquake occurs, energy radiates in all directions from its source , which is called the
AleksandrR [38]
Energy radiation is considered the term
4 0
2 years ago
Read 2 more answers
In fruit flies, straight wings are dominant and curly wings are recessive. What will the generations look like? Assume that Mend
anzhelika [568]

Answer:

The P generation has straight wings and curly wings.

The F1 generation has all straight wings.

The F2 generation has straight wings and curly wings.

Explanation:

This question involves a single gene coding for wing shape in fruit flies. The allele for straight wings (S) is dominant over the allele for curly wings (s). This means that allele "S" will mask the phenotypic expression of allele "s" in a heterozygous state.

According to the question, the cross follows all Mendel's method of crossing two true breeding parents with opposite traits. Hence, the parent generation (P generation) will be between a truebreeding straight wings parent (SS) and a truebreeding curly wings parent (ss). (See attached image for full cross).

Since the straight wing allele (S) is dominant, all the F1 offsprings  will possess straight wings with the genotype: Ss, which is heterozygous.

If this F1 offsprings are self-crossed i.e. Ss × Ss, four possible offsprings in the phenotypic ratio 3 straight wings : 1 curly wing will be produced in the F2 generation. The offsprings will possess the following genotypes: SS, Ss, Ss, and ss.

Offsprings SS, Ss, and Ss will all be phenotypically straight-winged

Offsprings ss will be phenotypically curly-winged.

In overall, this means that P generation has both straight and curly wings (SS and ss), F1 generation has only straight wings (Ss), F2 generation has both straight and curly wings (SS, Ss and ss).

7 0
2 years ago
Other questions:
  • Which is a waxy, water-repelling outer covering of a plant?
    6·2 answers
  • Which body parts don’t fossilize because animals tend to consume them?
    8·2 answers
  • A student has written a paper about a deer population that was separated when a canyon developed between members of the group. I
    7·2 answers
  • Meiosis results in _____.
    13·1 answer
  • The first invertebrates to develop a true nervous system are
    14·1 answer
  • Under a microscope, the cells of the mushroom plants and animals all have visible nucleus. This makes them all:
    5·2 answers
  • Christie's doctor recommends that she eat 40 grams of protein a day. She's already consumed 50% of her protein recommendation fo
    8·1 answer
  • To perform the experiment, Jared will follow these instructions: Put one or two ice cubes in one cup of water. Chill the cup of
    7·1 answer
  • According to catastrophists what was the rate of geological change?
    15·1 answer
  • You and your lab partner are looking at a sample of pond water under a microscope. Which statements are TRUE about what you see?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!