Answer:
The statement that accurately compares and contrasts the red blood cell and the white blood cell is that both have the same copy of DNA, but different genes are expressed in the two cell types.
Explanation:
Red blood cells (RBC) and white blood cells (WBC) are two highly differentiated types of cells that come from the hematopoietic system and have different functions in the blood.
Compared to WBC , RBC cells lack a nucleus and have fewer organelles, and their function is to transport gases in the blood, unlike the former which are involved in the body's defence.
<em>Cell differentiation is based on gene expression of the genome, resulting in different types of proteins synthesized in each cell, which give them a different structure and function.
</em>
Both <u>WBC and RBC have the same genome</u>, but different genes are expressed in each, giving them different morphological and functional characteristics.
Learn more:
Stem cells - cell differentiation brainly.com/question/182160
Out of the following given choices;
A. The cell is unable to get more water into the cell.
B. The cell is unable to build more protein molecules.
C. The cell is unable to produce water molecules inside the cell.
D. The cell is unable to maintain a stable internal environment.
<span>The answer is D. Due to high amounts of proteins in the cell, osmotically
active proteins cause the internal environment of the cell to be hypertonic to
the extracellular fluid. This causes excess water to enter the cell by osmosis and
resulting in lysis. </span>
Answer:
B. physical anonymity.
Explanation:
Anonymity can be explained in psychological research as a situation whereby the data collected from participants is confidential and cannot be traced to any particular individual.
Deindividuation is known to be a phenomenon in which people engage in seemingly impulsive and sometimes violent acts in situations in which they believe they cannot be personally identified.
In this case, people that are not physically present tend to be more hostile or engaged in some cruel act. This is because they know they can be seen face-to-face, and people will not know that they are the perpetrator of the act.
Answer: pH 5 Acidic environment.
Explanation:
The fungi grows best in the acidic environment, this is because the fungi grows in a moist, warm and darker environment.
The fungus grows at lower pH. When the fungal species was grown in the laboratory conditions then under low pH, the fungal species grow more properly.
Hence, the best environment for the growth of fungus is pH 5.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
