Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
I would say D. poor spatial awareness because cattle can be easily startled by sudden movements or objects coming into their vision.
The TYR, TRP2, and TRP1 genes are located next to each other on a single chromosome and are organized into an operon is most likely to be accurate.
The option a is correct.
Explanation:
The genes for the Tyrosinase, TRP2 and TRP1 are located on the same chromosome and are operons. These are operons because they are controlled by same transcription factors on mRNA.
Tyrosinase enzyme is important for the synthesis of melanin, eye pigments and hair colour. The synthesis of all these is completed in three distinct reactions catalysed by TRP1, TRP2 and Tyr genes. These work as operon and the protein product is almost 40% similar of the three genes.
The amount of melanin production depends on tyrosinase enzyme activity of all the three genes.
The genetic regulation is done by operons.
The best and most correct answer among the choices provided by your question is the second choice.
<span>Land breeze blows during the night in coastal locations because sea gets heated up faster than land at night. </span>
I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
