Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Non carbohydrates refers to those food which are not carbohydrates, which means that, these food do not supply energy and one can not possibly grow fat by eating them too much. Examples of non carbohydrate foods are egg, meat, fish, poultry, etc.
Non carbohydrates foods usually play other roles in the human system other than providing energy.
Answer:
This question is incomplete; the complete part is:
Which of the following best explains the reactions of these enzymes?
A) Amylase aids in the removal of a water molecule to break covalent bonds whereas glycogen synthase aids in the addition of a water molecule to form covalent bonds.
B) Amylase aids in the addition of a water molecule to break covalent bonds whereas glycogen synthase aids in the removal of a water molecule to form covalent bonds.
C) Amylase aids in the addition of a water molecule to form covalent bonds whereas glycogen synthase aids in the removal of a water molecule to break covalent bonds.
D) Amylase aids in the removal of a water molecule to form covalent bonds whereas glycogen synthase aids in the addition of a water molecule to break covalent bonds.
The answer is A
Explanation:
In nature, MONOMERS are simpler units that come together to form larger units called POLYMERS. According to this question, Amylase converts carbohydrate polymers to monomers while Glycogen synthase converts carbohydrate monomers to polymers.
Monomers of carbohydrate are joined together by adding water molecule to form covalent bonds between the monomer units, hence, forming a POLYMER. This is how Glycogen synthase catalyzes its reaction of forming carbohydrate polymer (glycogen).
On the other hand, Amylase breaks down large polymer molecules into monomers by removing water molecules in a process called HYDROLYSIS. This breaks the covalent bond that holds the monomeric units together.
Answer:
The correct option is A.
Explanation:
As we know that genetic variation that result from crossing over depend on the number of genes and their alleles. When there are more genes in genome the chances of polymorphic loci will increase, which will result into more genetic variation during crossing over.
Forexample:
Drosophila melanogaster is a common fruit fly having diploid number of 8 chromosome composed of 122,653,977 base pairs, and about ~17,000 genes. Honey bees have diploid number of 32 chromosomes composed of approximately 2360000 base pairs, and 10,000 genes.
Conclusion:
As fruit fly genome contain more genes and polymorphic loci, so genetic variation is more likely to be greater in fruit fly.
